1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Murrr4er [49]
3 years ago
11

BRAINLIESTTT ASAP!!! :)

Biology
2 answers:
Natalka [10]3 years ago
7 0
It’s D. Jupiter is farther and the moon is the closest
soldier1979 [14.2K]3 years ago
6 0

From all the possible options Jupiter is the furthest planet from Earth, which means the fourth option is correct.


Hope it helped,

Happy homework/ study/ exam!

You might be interested in
HLO GUYS !!<br>What is photosynthesis ?<br>Anyone need any help ?​
Mariana [72]

Answer:

process by which green plants prepare their own food

Explanation:

-,-

6 0
2 years ago
Read 2 more answers
Damage to sensory receptor cells would most likely result in ________. I. confusion of visual and auditory input II. inaccurate
MatroZZZ [7]

Answer:

The correct answer is: None of the above. The accurate answer is: Problem or inability in detecting the sensory information.

Explanation:

  • Sensory receptor cells form the part of the sensory epithelial layer that are present in the form of a lining in all sensory organs.
  • These sensory cells possess some specialised receptor molecules, usually on the surface of the cells, that can sense different types of sensory signals like light, in case of eyes, smell is case of nose, taste in case of tongue and sound in case of ears.
  • Any damage caused to these cells will adversely affect their capability to perceive or receive or detect the sensory signals.
  • Option I is incorrect because sensory cells are not only present in the eyes and ears but also in nose, tongue, skin. The activity of the sensory cells of one organ is independent of the activity of sensory cells of other organs hence, damage to the sensory cells of one organ will not create any confusion in different sensory inputs.
  • Option II is incorrect because integration of all the sensory impulses occur in the brain after the impulse has been received and detected by multiple sensory receptor cells and send to the brain through the sensory neurons.
8 0
3 years ago
Association between a fungus and plant roots is called
seraphim [82]

Answer:

Explanation:

Mycorrhizae are symbiotic relationships that form between fungi and plants. The fungi colonize the root system of a host plant, providing increased water and nutrient absorption capabilities while the plant provides the fungus with carbohydrates formed from photosynthesis.

8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which of the following is not caused by a virus?
Lemur [1.5K]

Answer:

Tuberculosis.

Explanation:

it is caused by a bacterium which can attack any part of the body such as the kidney, spine, and brain. not everyone infected with TB becomes sick

4 0
2 years ago
Other questions:
  • "tamara has been reporting blindness and numbness in her hands but her doctors cannot find any physical or medical explanation f
    13·1 answer
  • The size and shape of earths surface features both on and off a map is referred to as the
    5·1 answer
  • Respiration releases carbon dioxide, the molecule needed for photosynthesis.
    15·1 answer
  • Norway is a country famous for its fjords true or false
    6·2 answers
  • Does candle have cells
    12·2 answers
  • HELP
    15·2 answers
  • A solid is that form of matter that possesses the following
    14·1 answer
  • What were pregnant women exposed to and what were some of the ways it affected their
    8·1 answer
  • 4.
    8·2 answers
  • Why is the cell theory and the theory of evolution considered theories ?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!