1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VikaD [51]
3 years ago
14

A 35-year-old female client who complains of weight gain, facial hair, absent menstruation, frequent bruising, and acne is diagn

osed with cushing's syndrome. cushing's syndrome is most likely caused by:
Biology
1 answer:
olchik [2.2K]3 years ago
8 0
A pituitary glad tumor releasing too much hormones
You might be interested in
Please help i am giving brainliest
yan [13]

Answer:

a.Brain

Explanation:

Hypothalamus: The hypothalamus  is in the lower central part of the brain. It links the endocrine system and nervous system. Nerve cells in the hypothalamus make chemicals that control the release of hormones secreted from the pituitary gland.

3 0
3 years ago
Read 2 more answers
Evidence that cytoskeletal elements have ancient origins comes from the: sequence similarities of cytoskeletal elements when com
Gnesinka [82]

Answer:

All of these choices are correct.

Explanation:

A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature.

A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.

Generally, cells have the ability to independently replicate themselves. In a cell, the "workers" that perform various functions or tasks for the survival of the living organism are referred to as organelles. Some examples of cell organelles in all living organisms such as trees, birds, and bacteria include; nucleus, cytoplasm, cell membrane, golgi apparatus, mitochondria, lysosomes, ribosomes, chromosomes, endoplasmic reticulum, vesicles, cytoskeleton, etc.

Cytoskeleton refers to a structure consisting of filaments and tubules which help to maintain internal organization and support the shape of the cells. It comprises of three (3) main filaments and these includes: actin filaments, intermediate filaments and microtubules.

Generally, there are numerous evidence that cytoskeletal elements have ancient origins and they include all of the aforementioned facts.

3 0
3 years ago
In humans, which pair of homologous chromosomes does not look alike?
svlad2 [7]
The dominant and recessive pair, A
4 0
3 years ago
Read 2 more answers
Viruses have two main structures: a(n) _____ and genetic material.
Evgesh-ka [11]
These viral particles, also known as virions, consist of two or three parts: the genetic material made from either DNA or RNA, long molecules that carry genetic information, a protein coat, called the capsid, which surrounds and protects the genetic material. Hope this helped :)
4 0
3 years ago
Read 2 more answers
Invasive species always have a negative impact on an ecosystem. <br><br> A) True <br> B) False
Ganezh [65]
i think false because they can help with another animal and there population decrease
8 0
3 years ago
Other questions:
  • Which of the following methods are used by fungi to reproduce?
    10·1 answer
  • What analogy can you create that compares to the structure of all four major macromolecules?
    11·1 answer
  • A population of lizards lived in an ecosystem that was prone to flooding. After many generations, most of the lizards in the pop
    14·1 answer
  • Can someone who know this help me please?????
    11·1 answer
  • Extinction is a naturally occurring phenomenon. scientists now worry more about extinctions because _____.
    8·1 answer
  • are all of the cells in a multicellular organism exactly the same or do they have diffrent sizes and shapes?
    8·1 answer
  • GORAN<br> NARGO MYSETS<br> OMSRANOG<br> LECL<br> SUSTIE<br> Unscramble these words
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Help me PLEASE! Choose one answer! First one to answer get Brainliest!
    11·2 answers
  • An organism is able to maintain a stable internal environment despite changing external conditions. What is this called?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!