1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
never [62]
3 years ago
9

What is the major difference between modified thayer-martin (mtm) and chocolate agar?

Biology
1 answer:
shepuryov [24]3 years ago
7 0
Chocolate agar is essentially blood agar that contains lysed red cells and a couple of growth-promoting agents to grow organisms of Hemophilia and Neisseria.
You might be interested in
A patient wants to know why adh is important in the body. what is the nurse's best response? adh is important in:
Evgesh-ka [11]
<span>Controlling your blood pressure. It is the anti-diuretic hormone that works in your kidneys and blood vessels. It keeps the kidney from releasing too much water into the urine. ADH is made in the hypothalamus of your brain and then stored in the back of the pituitary gland.</span>
5 0
3 years ago
Which step can occur even more rapidly by PCR?a. target DNA removed from cells and isolated b. cloning host treated with calcium
lisabon 2012 [21]

Answer:

E. Gene is amplified by multiplication of cloning host

Explanation:

PCR is a very powerful technique that can help us to amplify exponentially one gene from a very small sample of DNA.

As seen in the attached image, the process begins with a single DNA molecule, for the first cycle, that DNA molecule denaturalizes into two strands, the primers bind to their complementary sides and then the DNA polymerase builds the new DNA strands. The number of copies of the gene that can be obtained with each cycle are 2ⁿ copies, where n is the cycle number.

7 0
3 years ago
Please help! anyone!
kari74 [83]
I would say oxygen because respiration is breathing mechanically.
8 0
3 years ago
Read 2 more answers
The mass extinction occurring today differs from those that occurred in the past because
ahrayia [7]
The main reason for the difference in the mass extinction occurring today and previously is the pace of the current extinction. The extinction is taking place globally and involves hundreds of species at the same time. In less than 50 years, we have lost numerous species. In contrast to this, previously during the mass extinction, only a few species were lost, and other managed to survive. But, not the status is opposite due to the magnitude of the extinction. 
3 0
3 years ago
Read 2 more answers
(Please leave an answer if you know the correct one!) I'm unsure of my answer, if you'd like to...could you please assure me of
lesya692 [45]

Answer:

D) The number of mitochondria has decreased due to long period of rest

You are correct :)

Explanation:

The basketball player requires energy so remember that the mitochondria is the powerhouse of the cell (so it produces energy).

4 0
3 years ago
Other questions:
  • I need the answers to this question super quick!! Thank yoh
    8·2 answers
  • What's the answer a d please explain the claim,evidence and reasoning.​
    7·2 answers
  • Which plant structure is most like gap junctions in animal cells?
    15·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • This group of unicellular and multicellular eukaryotes can be autotrophs or heterotrophs
    13·2 answers
  • The role of the cell membrane is most like the job of which person?
    9·2 answers
  • Can somebody help me
    7·2 answers
  • During the Human Genome Project, scientists created a gene map showing the relative location of each known gene on every human c
    5·1 answer
  • A polypeptide only becomes a functioning protein after it has folded into its exact 3D shape.
    5·1 answer
  • Johanna learns that the Law of Conservation of Energy states that energy is conserved, never lost. Which of the following best d
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!