1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valentina_108 [34]
3 years ago
5

During embryological development, the anus forms before the mouth in ___

Biology
1 answer:
marishachu [46]3 years ago
4 0
The answer would be humans
You might be interested in
How does altered ventilation and diffusion affect these processes?
mestny [16]
<span>Lungs take in air, and diffuse (absorb) air into the capillaries of the blood. However, this process is two steps, one for inhalation and one for exhalation. Diffusion takes place in both processes, and serves different purposes. One is to absorb oxygen, the other is to rid co2.</span>
3 0
3 years ago
What does the level of ATP tell scientists about the functioning of the heart
Nady [450]
The level of ATP tells the level of vitality inside heart cells, telling how well the heart capacities. The sorts of cells in the body that I would hope to require the most ATP are muscle cells. Muscle cells require bigger measures of ATP. They are in charge of the greater part of our developments. The majority of the vitality consumed amid your day is through development of your body by skeletal muscles.
3 0
3 years ago
What device transforms electrical energy into mechanical energy? a. an electromagnet b. an electric motor c. a generator d. an e
alina1380 [7]

Electric motors transform electrical energy into mechanical energy so the answer would be B.

Explanation:

7 0
3 years ago
What is the alignment of the Earth, moon, and sun during a solar eclipse?
zimovet [89]
The alignment of the earth, moon, and sun during a solar eclipse is Sun, Earth, moon.
3 0
3 years ago
Read 2 more answers
A. new oceanic plates moving together
Neko [114]
C) hotspot because it is pushing up causing the lava to go up
5 0
3 years ago
Other questions:
  • How many species of baobab trees found in Africa
    15·1 answer
  • Consider an animal cell in which motor proteins in the kinetochores normally pull the chromosomes along the kinetochore microtub
    7·1 answer
  • An important response mechanism in our bodies is blood clotting. The response loop is initiated when injured tissue releases sig
    5·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • 20 POINTS PLEASE HELP!!
    8·1 answer
  • The first cells activated by the antigens are called ?
    7·1 answer
  • Hey♥️<br>list the kinds of nuitrition in bacteria​
    5·1 answer
  • What does Na+ represent? select all that apply.
    10·1 answer
  • HELP HELP HELP WHATS 1+1 IM STUCK ITS SO HARD PLEASE HELP ME QUICK
    14·1 answer
  • at 21 degrees celcius, a cell with a pressure potential of 3.2 bar is at equilibrium with a 0.420 sucrose solution in an open be
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!