1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
babunello [35]
4 years ago
13

Which one of the following accurately describes the Lac operon?

Biology
1 answer:
andre [41]4 years ago
5 0

The lac operon, which stands for Lactose operon is known as an inducible system. It is the an operon required for the transport and metabolism of lactose some enteric bacteria (Echerichia coli for example). The Lac operon is only activated in the presence of a key molecule. The key molecule is lactose.
From the given options the following best describes the Lac operon:

D. The repressor is freed from the operator when lactose is present.

You might be interested in
An organic molecule contains carbon atoms. true or false
Roman55 [17]

Answer: i’m pretty sure that it does contain carbon atoms

Explanation: most organic compounds contain a significant amount of carbon

7 0
3 years ago
Read 2 more answers
How does power relate to work?
victus00 [196]

Answer:

D. Power is required in order for work to be applied on an object

6 0
3 years ago
Read 2 more answers
How many sex chromosomes does a human diploid cell contain?
KengaRu [80]

Answer:

<h2>. A human diploid cell has 46 chromosomes in 23 pairs.</h2>

4 0
3 years ago
Name two mammals that might pollinate a plant
Nana76 [90]

squirrel and deer. Other animals could be elephants,monkeys, etc

3 0
3 years ago
What would be the effect on blood flow if some arteries lost their elasticity? A) no affect on blood flow B) increased blood flo
jeka57 [31]
Decreased blood flow due to limiting the amount of blood
7 0
3 years ago
Read 2 more answers
Other questions:
  • An Electromagnet can be made by wrapping wire around witch object?
    12·2 answers
  • For all questions, assume that you have genes for beak color, tail-feather length, and feather color all linked (located) on the
    5·1 answer
  • What was the cell theory discovered through?
    13·1 answer
  • In your lab you are studying the genome of venomous rattlesnakes to find the gene which codes for their venom glands. You have t
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How do the DNA and genes in a muscle cell compare to the DNA and genes in a nerve cell?
    11·2 answers
  • In a dihybrid cross, the F2 will have nine genotypes, but only four phenotypes because the (Homozygous, Heterozygous) genes caus
    15·2 answers
  • Someone pls help? Jrhdnfmdmdk
    5·1 answer
  • 100 point question<br><br> Does redbull give you wings?
    13·2 answers
  • Worth 26 points! Help me please! Do 1,2,3 by filling in the blank!!!! And I will make you brainest!
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!