Answer:
having more air spaces around the spongy mesophyll cells
The answer is fusion of gametes via fertilization.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
It is <u>true </u>that i<span>n operant conditioning, many complex behaviors are learned through shaping.
This means that you learn many new things through consequences that you experience. So, for example, when you're a kid, you are constantly being told not to touch a hot stove. But given that you are small and inquisitive, you still touch it and burn your hand. After that, you learn that touching something hot is going to hurt you, so you learn not to do it through a consequence.</span>
B. Temperature and Precipitation
