1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
12

How do phagocytes fight pathogenicmicrobes?

Biology
2 answers:
Masteriza [31]3 years ago
7 0
They surround and engulf foreign objects and organisms- process called phagocytosis
Zolol [24]3 years ago
5 0

Answer: Option C

Explanation:

The process of phagocytosis can be defined as engulfing the foreign particles and harmful organism so that they cannot harm the body.

When the body gets exposed to different types of foreign materials then there are chances that the body can come across different types of pathogens.

In this case the body response and the phagocytes engulf all the pathogens and organism so that the body is free from infections.

You might be interested in
What is the term for an organisms ability to survive and reproduce?
miskamm [114]

Answer: the answer is fitness

Explanation:

Environment is where the organism lives

Population is the amount of organisms

So fitness, also called Darwinian Fitness, is the correct answer

4 0
3 years ago
A sample of 2,000 individuals from a human population was scored for MN blood group. The following frequencies were found: 1,600
son4ous [18]

Answer:

Hardy Weinbergs equilibrium(HWE) states genetic variation in a population will remain constant in disturbing factors absence. It also talks about the sum of frequency of both alleles being 100 percent.

In the sample given above the total s of individuals is 2,000. The result of MM+MN+NN (1,600+250+150) gives 2,000 which is a 100 percent and satisfies Hardy Weinbergs equilibrium

4 0
3 years ago
In the Florida map shown below, use the law of superposition to determine which rocks are youngest?
dsp73
A because it’s in grey and you can tell it’s the youngest.
7 0
2 years ago
The repetition (AA), variation (AA'), and contrast (AB) of a piece of music are all part of the music's
Naya [18.7K]
B. Form ...it speaks to the set up of the piece
6 0
3 years ago
Trees flowers and grass are all examples of what type of natural resource
stellarik [79]
The answer to this question is the term vegetation. A vegetation are the plants that are found and covering a particular area or location. Vegetation is also known as the plant community. Natutal vegetation is the plant life where in it lives without the interruption of humans.
5 0
3 years ago
Other questions:
  • What is the scientific name for dog
    14·2 answers
  • Which type of medicine refers to a groups of medical treatments, practices and products that can be used in conjunction with con
    10·1 answer
  • Proces
    11·1 answer
  • What is the input energy of a wind up toy?
    15·2 answers
  • How does natural selection operate to cause change in a population?
    8·1 answer
  • What is the function of histones- proteins that aide in dna replication
    5·1 answer
  • Sawgrass takes in light energy during photosynthesis. What happens to most of this energy?
    11·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • In guinea pigs,short fur (S) is dominate to long fur (s). Two heterogeneous guinea pig (Ss) mate
    13·1 answer
  • If someone could dig a safe tunnel through the earth how long would it take to free fall to the center?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!