Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
When two or more organisms have the same type of physical features in them, it shows that the organisms might have evolved from a common ancestor. Such structures are known as homologous structures.
For example, the forelimbs of humans, birds, whales and dogs have the same kind of structural anatomy. Although, their functions might be different but their structures are similar. This similarity depicts that the organisms might have a common ancestor in the past.
The correct option is A.
Behavioral genetic is the scientific study of the relationship between gene and the environment; variations among individuals are separated into environment and genetic components. Research in behavioral genetic usually make use of families, twins and adopted individuals in order to determine variations among individuals.
Answer:
B. ) Nucleic acids to amino acids
Explanation:
Translation happens after DNA has already been copied into RNA and is now going to be translated from its form as RNA to a protein/ Amino Acid.
Answer:
vole rat shrew mouse
Explanation:
they are all types of mice