1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
6

It is difficult to determine a definition for life that is suitable for all situations. Instead of defining life, biologists hav

e decided to _____.
describe the characteristics of life
determine if something is living or non-living based on its complexity
qualify life based on whether something can move or not
determine something is living if it responds to outside stimuli
Biology
2 answers:
Evgesh-ka [11]3 years ago
5 0

It is difficult to determine a definition for life that is suitable for all situations. Instead of defining life, biologists have decided to describes the characteristics of life.

Answer: Option A

<u>Explanation:</u>

How might we tell that one thing is alive and another isn't? The vast majority have a natural comprehension of what it implies for something to be alive. Nonetheless, it's shockingly difficult to concoct an exact meaning of life.

Along these lines, numerous meanings of life are operational definitions they enable us to separate living things from nonliving ones, yet they don't really bind what life is. To make this partition, we should concoct a rundown of properties that are, as a gathering, exceptionally normal for living creatures.

Thus attempting to define what life is, biologist have distinguished different attributes normal to all the living creatures we are aware of.

agasfer [191]3 years ago
4 0
The correct answer is the first one: biologists describe the characteristics of life rather than providing a definition. Some of the characteristics include:
growth
reproduction
metabolism (using and transforming energy)
organisation (into multiple cells or within the cell)
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Jhcnccnnmdcnm<br>Describe
lawyer [7]

Answer:

Describe......What?

Explanation:

7 0
3 years ago
Read 2 more answers
Arrange the items listed into different groups. Give each group a title indicating what the members of that group have in common
Finger [1]

Answer: The caterogries are fruit and vegtables

Explanation: The fruits are: apple, orange, banana, pear, and grape.                  The vegtables are: peas, carrot, lettuce, turnip, and potato

5 0
3 years ago
Which of the following is not a part of Darwin’s theory of evolution
murzikaleks [220]

Answer:The question has already been answerd here >https://www.proprofs.com/discuss/q/520196/which-of-the-following-is-not-part-darwins-theory-evolution

In summery the answer is: E. Acquired traits can be inherited

6 0
3 years ago
The main sugar that is used as a reactant in cellular respiration is called blank
laila [671]
I think it’s glucose
4 0
3 years ago
Read 2 more answers
Other questions:
  • If lakes were made of ethanol instead of water, how would that affect organisms living there?
    7·2 answers
  • Are most vitamins and minerals present in amounts at or near 100% of the adult dri?
    9·1 answer
  • Conduction involves the transfer of electric charge or______.
    8·1 answer
  • What shape does the graph of a linear relationship take? ​
    5·2 answers
  • How do scientists determine the actual age of fossils
    9·1 answer
  • What r 5 main reasons for getting a nosebleed
    6·1 answer
  • Describe Genotypic Species Concept
    11·1 answer
  • What characteristics would be found in the center of the Venn diagram? *
    13·2 answers
  • How does weathering and erosion from waves cause<br> landforms to develop?? NEED HELP ASAP PLEASE!!
    13·1 answer
  • Which organisms DNA will have the most in common with the chimpanzee
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!