1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nastasia [14]
3 years ago
14

3. Why are young people especially vulnerable to contracting an STD?

Health
1 answer:
Sergeeva-Olga [200]3 years ago
3 0

Answer:

Sizable numbers of adolescents are sexually active. ... Their immature reproductive and immune systems make adolescents more vulnerable to infection by various STD agents.

Explanation:

You might be interested in
When it comes to mental disorders, what is true of cultural customs and beliefs? Customs really don't determine what is consider
bija089 [108]
I think the answer is that no answer is correct.
6 0
3 years ago
Read 2 more answers
How would you distinguishequity from liability
meriva

Well, basically, equity means being fair, or impartial, while liability means being responsible for something, especially in the eyes of the law.

There's a big difference between the two.

7 0
3 years ago
Which of the following is it an effective way to help prevent further injury once you have been hurt
DochEvi [55]
Updating you workout clothes and gear is NOT an effective way to help prevent further injury once you have been hurt.
3 0
4 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
True or False: Praticipating in physical activities can improve health-related fitness
Lostsunrise [7]
This statement is true because "Participating in physical activities always will improve your health in anyway and every way possible. 
It just good for you."
8 0
3 years ago
Read 2 more answers
Other questions:
  • How long does effexor xr stay in your system?
    10·1 answer
  • Despite a wide variety of workplaces for those working in human services all workplaces include
    5·1 answer
  • Becky used to be able to touch her toes while standing, but now she cannot reach them. What aspect of her physical fitness has c
    7·2 answers
  • Jared had to quit his job because while he was at work, he constantly worried about a wide variety of things, including what his
    5·1 answer
  • ok guys basically i cant rest i dont have medicine besides ibprophen and i dont think im going to the doctors for at least a wee
    14·2 answers
  • A client has recently been diagnosed with rheumatoid arthritis, and is also receiving further testing for disorders of the immun
    12·1 answer
  • Which best describes a phobia?
    14·2 answers
  • OSHA requires employers to keep the MSDS on file for all hazardous chemicals or drugs used in the facility.
    12·1 answer
  • Which of the following statements about joints is TRUE? A. Fixed joints have the greatest range of motion. B. Most joints are jo
    6·2 answers
  • Based on your pie chart results, what were your major influencers when came to eating?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!