1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FrozenT [24]
3 years ago
6

Hundreds of years ago, a volcanic eruption killed many plants and animals on a tropical island. Today, the island looks much as

it did before the eruption. Why is this true? Destroyed ecosystems always return to their exact original state. Altered ecosystems only regain stability from the development of grasses. Geographic barriers prevent the migration of animals to island habitats. Destroyed environments can recover through ecological succession.
Biology
1 answer:
anyanavicka [17]3 years ago
3 0

Answer:

Destroyed environments can recover through ecological succession.

Explanation:

Ecological succession describes a progressive change in the species in an ecological community over time.

This can happen after some disturbance such as a fire, earthquake, or volcanic eruption. It can mean that a e can return to the state it was before the event.

You might be interested in
What is sex linked inheritance
nasty-shy [4]
Sex linked inheritance is a trait that is passed through generations in which is linked directly to an individuals gender or sex. most of the time sex linked inheritance is seen in males however it can be viewed in females.
7 0
3 years ago
Answerr these questions please!!! will mark brainliest. They are simple
aleksklad [387]
What’s the question?
7 0
3 years ago
During the process of protein synthesis, a section of DNA molecule is copied into which other molecule?
Lilit [14]
Hi the answer to this isD.hope this helps.
4 0
3 years ago
What is a gene? a single strand of DNA. the fundamental unit of heredity. a single nucleotide. the fundamental unit of DNA
const2013 [10]

Answer:

the fundamental unit of heredity

Explanation:

DNA is a double stranded helix structure. Each strand is made up of a string of nucleotides.

A gene is a region of DNA, usually tens of thousands of nucleotides long. At the simplest level, one gene encodes for one trait. Therefore, the gene can be described as the fundamental unit of heredity.

Genes work by coding for specific proteins, which carry out essentially all the functions in the cell.

6 0
3 years ago
Oxygen moves from the lungs to the blood
ArbitrLikvidat [17]
B I think is the correct answer
5 0
3 years ago
Other questions:
  • A bite from an undomesticated animal may require a rabies shot<br> a. True<br> b. False
    9·2 answers
  • Which processes are part of the fast carbon cycle?
    6·2 answers
  • Easy question, easy 100 points
    15·1 answer
  • You are researching a cytoplasmic protein associated with a nerve disorder. The native form of the enzyme appears to be globular
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Provide 3 points of interest about Transcription of the cell.
    13·1 answer
  • List 5 ways we can help the ocean and the organisms living in it.
    12·2 answers
  • 1. What are the four nucleic acids that make DNA?
    7·1 answer
  • What happens if I recycle my plastic consumption
    12·1 answer
  • A scientist is investigating the effects of electromagnetic radiation on plant growth. She wants to test the plants with two dif
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!