1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
attashe74 [19]
3 years ago
5

Explain how trees can be producers and yet the smallest trophic level in a pyramid of numbers.

Biology
2 answers:
gavmur [86]3 years ago
8 0

Answer:

The trees are large as compared to the organism that lives on it, like insects, rodents, birds. A tree has much more biomass as compared to the consumers that depend upon it. It means that it is still at the base of the biomass of the pyramid and pyramid of energy.

The number of the organism in the lower level of the pyramid of a number will be less, but when we consider the pyramid of biomass it will be larger and found at the bottom.





lesantik [10]3 years ago
6 0
Oh ok, because producers make up the largest amount of biomass in most food chains, so they put it in the bottom of the pyramid, because the base of the pyramid is the largest part of it.   
You might be interested in
Please help me!
Annette [7]
The answer would be...
(B) Respiration

Hope this helped!!… :D
5 0
4 years ago
Read 2 more answers
The longer the wavelength
Dominik [7]
B I think is the correct answer
4 0
3 years ago
An organism that harbors a parasite, mutual partner, or commensal partner, typically providing nourishment and shelter.
Stolb23 [73]

Answer:

Host

Explanation:

8 0
3 years ago
Select all the molecules that have stored potential energy and that can be used in aerobic respiration to generate atp.
Masteriza [31]

Carbohydrates, lipids, and protein have potential energy, and can be used in aerobic respiration to generate .

Carbohydrate- A carbohydrate is a naturally occurring substance or a derivative of one, made composed of molecules of carbon, hydrogen, and oxygen. The most prevalent organic compound is a carbohydrate, and all life depends on them.

Lipids- Fatty, waxy, or oily molecules are referred to as lipids. They are soluble in organic solvents but insoluble in polar solvents like water.

Protein- Large, intricate molecules known as proteins serve a variety of vital functions in the body. They are crucial for the construction, operation, and control of the body's tissues and organs and carry out the majority of their job inside cells.

To know more about the ATP, click on the below link,

brainly.com/question/174043

#SPJ4

3 0
2 years ago
________________ is the ability of a microscope or camera lens to separate what to the unaided eye appears to be one object into
lyudmila [28]

Answer:

Resolution.

Explanation:

This is the ability to  distinguish between two separate  points.  if two  separate points can not be seen separately, but as a single  point,  they can not be resolved.   Consequently Resolution  is the amount of  details of an object that that can be seen. Thus the more  the  higher  the resolution of an object the more  the detail of the object that can be seen.

For example the maxiimum reso;ution of  light microsope is 20nm<u>. Therefore if two objects are placed together more than 20nm apart , they can not be seen(resolved); that is  distinguished from one another by light microscope,This is the limImitation of light microcope.</u>

Electron microscope makes use of beam of electrons for focusing, therefore has resolution than light microscope

4 0
3 years ago
Read 2 more answers
Other questions:
  • If the parent genotypes are Aa and Aa, the offspring are expected to be _____.
    15·2 answers
  • What can show how life has changed on Earth?
    14·1 answer
  • What might happen to an organism that uses asexual reproduction if the average temperature of its habitat changes?
    8·1 answer
  • Plants are members of the eukaryotic supergroup ________ , and their closest relatives are _________. Plants are members of the
    12·1 answer
  • Compound microscope write the figures​
    14·1 answer
  • Kennedy I love you I am gay and I know you are to so please answer I willing give you brainist please don’t answer until she ans
    13·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Please help me
    12·1 answer
  • There is more then one answer to the question. What does the brachiocephalic divide into? There is more thane one answer to the
    5·1 answer
  • HELP.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!