1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
3 years ago
14

What two chemicals result when rhodopsin decomposes ?

Biology
1 answer:
koban [17]3 years ago
4 0

Well, two chemicals that result from rhodopsin decomposing would be Retinal and Opsin.

hope it helped :))

You might be interested in
1. A mutation that causes changes in the amino acid sequence downstream of the mutation is called
Maslowich
A frameshift mutation to chromosomes will cause the amino acid sequence after the mutation to change. Most likely all of the above are correct for the second question.
5 0
4 years ago
Read 2 more answers
what structural differences makes adenine and guanine different from cytosine, thymine, and uracil? (figure 2-24)
Vsevolod [243]

Answer:

Nitrogenous bases have two distinct families known as purines and pyrimidine, nitrogenous are the building blocks or monomer units of the nucleic acids.

The major and significant difference between purines and pyrimidines is the difference in their structures-

The purines are divided into two different bases called adenine and guanine and each of them have a two-ringed structure formed with a 9-membered molecule and 4 nitrogen atoms which makes it a large in size than purines.

The pyrimidines are divided into 3 bases that are cytosine, uracil, and thymine and all these have only one single ring of six members and 2 nitrogen atoms.  These are smaller in size.

4 0
3 years ago
What the definition of DNA
pav-90 [236]
It is <span>deoxyribonucleic</span> Acid that is kind of what makes you, you. Which also tells us about our genetic information that is used in our development. All Living organisms like us humans and animals have our own DNA. 
4 0
3 years ago
Fill in the Blanks
LuckyWell [14K]
I wish could see a picture or a screen of it ! :)
7 0
3 years ago
A dark brown/black layer surrounding most of the eye which prevents light scatter within
Novay_Z [31]
The answer is Choroid.
5 0
3 years ago
Other questions:
  • Which of the following can not be broken down by any herbivores digestive system
    5·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Hormones are secreted by exocrine glands directly into a body cavity or onto a body surface, rather than being transported by th
    12·1 answer
  • What type of chromosome mutation is shown in the image below?
    9·1 answer
  • How does thermal energy move?
    11·2 answers
  • _________ inherited traits that increase an organisms chance of survival, also determine an organism’s niche.
    9·1 answer
  • (HELP ASAP I'LL GIVE YOU BRAINLIEST)
    5·1 answer
  • Which statement is not a part of the cell theory
    9·2 answers
  • Can someone plz help me? :)
    5·1 answer
  • How the fruits and vegetables made available in the off seasons?​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!