1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina1246 [14]
3 years ago
8

Do you agree with the statement that they "replace" the human heart?

Biology
1 answer:
Alex777 [14]3 years ago
7 0
Not necessarily. I have no background on this kind of thing. I would say that they do not only for the facts of 1, where would they get a new heart? 2, I was born with three holes in my heart (I swear to God) and merely got patches. 3, Replacing the heart would be hard so as though when your heart stops beating you die. There would be only a very small space of time that would have to do so.  
You might be interested in
Which metabolic pathway would be utilized for sprinting?
Eddi Din [679]

Answer:

b) electron transport chain

Explanation:

During sprinting, muscles need a constant supply of ATPs (the energy currency of cells) to support the continuous movement. The electron transport chain is present in the inner mitochondrial membrane.

Oxidation of NADH and FADH2 through electron transport chain produces proton gradient across the membrane which in turn drives the synthesis of a large number of ATPs to support sprinting.

4 0
3 years ago
Xavier drew a diagram to compare the roles of oxygen and hydrogen in photosynthesis.
Elan Coil [88]

Answer:

Is released into the air through stomata

Explanation:

Oxygen and hydrogen both exists as gaseous molecules in the atmosphere. However, one of them (oxygen) is a product of photosynthesis while the other (hydrogen) is one of the constituents of the molecule that starts the process of photosynthesis.

According to this question, the X used in the attached diagram is the role of oxygen in photosynthesis. Oxygen is released as a product of photosynthesis and goes out of the plant into the air via the STOMATA. Hence, the gas released into the air via stomata is OXYGEN.

4 0
3 years ago
What is a density-independent factor in controlling a population?
elena55 [62]
Diseases are the most deadly compared to water supply, tornados, and access to food. And more and more people are dying from diseases as the world gets worse .
Plz mark brainliest
4 0
3 years ago
Explain the importance of ATP at cellular level
Kryger [21]
The main role of ATP<span> is to provide energy

</span>energy released is used for metabolism in thecell<span>. Other reactions that require energy from </span>ATP<span> include; active transport/ muscle contraction/ glycolysis.</span>
8 0
3 years ago
The allele for white eyes is located at loci 12 while the allele for hairy body is located at loci 16 on one chromosome. The all
Darina [25.2K]

Answer:

white eyes and hairy body

Explanation:

Based on the scenario being described within the question it can be said that the allele combination that has the greater map distance would be white eyes and hairy body . This is mainly due to the fact that this combination have four map units between them, when compared to the other same chromosome combinations which, the next runner up would be red eyes and normal body with two-units between them.

6 0
3 years ago
Other questions:
  • Which of the following is a product of respiration resulting from the breaking of carbon-carbon bonds? a. glucose b. oxygen c. c
    13·2 answers
  • 1. Which of the following correctly describes homeostasis in protists?
    9·2 answers
  • Which is one disadvantage of using gas hydrates?
    14·2 answers
  • What do you observe happening to the wavelength and frequency of the wave under the spectrum as you slide the green arrow from l
    9·1 answer
  • Finch species living on the Galapagos Islands exhibit a variety of beak types that favor different foods. Finches that eat seeds
    10·1 answer
  • Describe the importance of the cell membrane containing both polar and non polar parts
    14·1 answer
  • Fructose is a molecule that can move across the cell membrane. if the concentration of fructose is higher outside the cell than
    13·2 answers
  • Chemical substances in plants that act as internal stimuli are called
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Question 8 of 24
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!