I believe A translates to U, T transtates to A, G translates to C, and C traslates to G.
<span> ATGCGCTGCACGTGCACGTTTACGCGACGTGCACGTGCAA
</span>
mRNA
UACGCGACGUGCACGUGCAAAUGCGCUGCACGUGCACGUU
When atomic orbitals mix and form a new atomic orbital
Answer
the human appendix, the pelvic bone of a snake, and the wings of flightless birds.
Explanation:
Answer:
C
Explanation:
In this question, we want to select which of the options that correctly attributes recent changes in climate to human activities
The correct answer is that global climate models can only reproduce recent temperature increases when anthropogenic green house gas emissions are included as forcing
What we have here is that for the models to show a pattern of temperature increase that we have seen recently, there must be a substantial effort by humans to have increased green house gases emission as a direct result of their activities
So this clearly put in the pattern detection of temperature increase by the model as a result of human actions thereby directly attributing what the model has developed as a result of what men has put into action