Glycolysis produces pyruvic acid, which enters the mitochondrion. There, it is converted to acetyl CoA, which enters the citric acid cycle. Electron carriers bring electrons from the first three steps to the electron transport chain, and ATP is made.
Answer:
Explanation:Explanation: Classification of organisms is a hard task cause many organisms have their differences and similarities, whereby making it very complicated in classifying organisms.. All living organisms are classified into groups based on very basic, shared characteristics
(studying this for AP Bio test, feels good man)
Fossil Records: shows the large amounts of time in which simple organisms have evolved into complex organisms
Comparative anatomy: in many different types of vertebrates, many bones are similar, indicating a common ancestor in the past, these bones are homologous in different vertebrates
Comparative embryology: many embryos of developing vertebrates will look similar and develop similar structures in its respective time in the womb
Bio Geography: many fossils and creatures are found in such distant places that it is impossible for them to have migrated, only because the Earth was once a large land mass (Pangea). And many animals of the same special developed some differences to cope with the surrounding environment.
Molecular Biology: similar DNA sequences, genomes
Observed evolutionary change: changes in the alleles of a population, mutation, genetic drift, etc.
The mitochondria is the part which is responsible for the cell's energy
Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary <u>DNA strand</u>.