1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faltersainse [42]
4 years ago
12

An individual has a mutation in the gene that codes for hemoglobin. This results in sickle cell disease. Choose the correct expl

anation for how this mutation affects the individual's traits.
a. The error in the DNA sequence results in an error in the mRNA molecule during transcription, the error in the mRNA molecule results in an incorrect amino acid in the hemoglobin protein which makes it non-functional. The resulting trait is sickle cell disease.
b. The error in the mRNA sequence results in an error in the DNA molecule during transcription, the error in the DNA molecule results in an incorrect nucleic acid in the hemoglobin protein which makes it non-functional. The resulting trait is sickle cell disease.
c. The error in the DNA sequence results in an error in the mRNA molecule during transcription, the error in the mRNA molecule results in an incorrect nucleic acid in the hemoglobin protein which makes it non-functional. The resulting trait is sickle cell disease.
d. The error in the mRNA sequence results in an error in the DNA molecule during transcription, the error in the DNA molecule results in an incorrect amino acid in the hemoglobin protein which makes it non-functional. The resulting trait is sickle cell disease.
Biology
1 answer:
elena-s [515]4 years ago
3 0

Answer:

a

Explanation:

<em>The correct answer would be that the error in the DNA sequence results in an error in the mRNA molecule during transcription, the error in the mRNA molecule results in an incorrect amino acid in the hemoglobin protein which makes it non-functional. The resulting trait is sickle cell disease.</em>

<u>The direction of the flow of information during genetic inheritance is from DNA to mRNA and finally to protein</u>. The information in the DNA is encoded into mRNA during transcription and the encoded information is translated into protein during the process of translation.

Hence, once there is an error in the DNA, the error is passed on to the mRNA during transcription. The consequence of this error is that the wrong amino acid is translated from the wrong codon.

Hence, the substitution of the correct amino acid by the wrong one in the hemoglobin protein results in a defect or non-functional protein. One of the phenotypic implications of this kind of error is sickle cell disease.

The correct option is a.

You might be interested in
The pressure against the walls of the blood vessels as blood is ejected from the heart and circulates through the body is the​ _
laiz [17]
Its the systolic blood pressure
5 0
3 years ago
How do extrusive igneous rocks differ from intrusive igneous rocks?
Rina8888 [55]

Answer:

The difference between intrusive and extrusive igneous is that, intrusive rock is one that forms when magma cools within Earth. Extrusive igneous rock is one that, forms when lava cools on Earths surface.

5 0
3 years ago
A type of worm with many linked sections is a flatworm.<br><br> True or False
sukhopar [10]

Answer:

False.

Explanation:

Flatworms are unsegmented.

8 0
3 years ago
Question 6 (5 points)
Schach [20]

Answer:

The answer is Endocrine neurons

Hope this helps

4 0
4 years ago
If carbon has a temperature of 3000 °C, what state is it in?<br> solid<br> liquid<br> gas
Tamiku [17]

Answer:

Explanation:

3000 degree carbon is in co2

Gas state

4 0
3 years ago
Read 2 more answers
Other questions:
  • I will mark brainliest
    8·1 answer
  • What cell structure would be involved in digesting worn out ribesomes?
    7·1 answer
  • WILL MARK BRAINLIEST GIVE ME A 3-4 SENTENCE EXPLANATION OF WHAT IS PHOTOSYNTHESIS
    10·1 answer
  • Geoscientists use ___________ to explore the deep layers of the earth that humans can not yet dig down into.
    8·1 answer
  • Energy plus matter is sufficient for continued development of order, complexity or growth. TrueFalse
    14·2 answers
  • ABCD are the same for all questions someone please help...
    5·1 answer
  • Which characteristics do Neptune and Uranus share? Check all that apply.
    12·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Three complex carbohydrates that are very important in living things are starch, cellulose, and glycogen (see below).. All three
    7·1 answer
  • MARK YOU THE BRAINLIEST!<br> What make a Weeping Willow a eukaryotic cells give three reason why ?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!