1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kaylis [27]
2 years ago
14

Which of the people listed below was a leader of this empire?

Geography
1 answer:
katen-ka-za [31]2 years ago
6 0
The answer is d. Genghis Khan
You might be interested in
Which two elements are the inner core and outer core primarily made of?.
iragen [17]

The earth’s inner core is a solid ball of iron, nickel and other metals, while the outer core is liquid metal composed of iron and nickel as well. The temperature of the inner core is estimated to be about 5,400 degrees C or 9,800 degrees F, far beyond iron’s melting point.

8 0
1 year ago
The _________ says that sedimentary rock layers are laid down parallel to the ground.
Elis [28]

The answer is C. Law of original horizontality.

sedimentary layers are laid down horizontally when they're initially deposited.

6 0
3 years ago
What kind of map will show you where communist governments are located in the world.
maksim [4K]

Answer:

political system distribution

8 0
2 years ago
Read 2 more answers
How are marshes formed
Gelneren [198K]

Answer: Marshes can be formed by tides in lowland areas near a coast

Always happy to help.

Explanation:

4 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
2 years ago
Other questions:
  • The United States Highway System is a _____________ in the United States numbered within a nationwide grid.
    6·1 answer
  • It costs $60 to reserve a movie theater for a party. There is also a charge of $3 for each person. Which expression represents t
    14·1 answer
  • As the geology officer on an expedition to a newly discovered, Earthlike
    12·2 answers
  • This is a map of South Korea, which is located north of the Equator. Where is Seoul, the capital city of South Korea, located?
    6·1 answer
  • The North Atlantic Current makes Norway
    15·2 answers
  • ATB: Why do people use maps which are flat to help them find
    11·1 answer
  • Please help me with this question​
    7·2 answers
  • Explain Europe's cultural diversity. please this is my last assignment.
    8·2 answers
  • How do movements and interactions of air masses cause change in the weather?
    5·1 answer
  • Which are considered two of the special properties that are used to identify certain minerals?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!