1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
5

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

TAG-3
​
Geography
1 answer:
Rina8888 [55]3 years ago
7 0

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

You might be interested in
Which of these best describes the asthenosphere inside of the earth's mantle?
Reptile [31]
Asthenosphere is the upper of the Earth's mantel, below the lithosphere, in which there is relatively low resistance to plastic flow and convection is thought to occur. (Hopefully This helps)
6 0
4 years ago
Read 2 more answers
Describe how erosion wears down Earth's surface
d1i1m1o1n [39]
Erosion is the process of eroding or being eroded by wind, water, or other natural agents. Erosion occurs in many things like rain water hitting the ground or wind hitting mountains. These processes are always happening without stop.
3 0
4 years ago
Read 2 more answers
eview the statements below. Two of these statements are true of conglomerate sedimentary rock similar to the one shown in the Gi
svp [43]

Answer: Option A and D can best describe conglomerate sedimentary rock.

Explanation: Conglomerate sedimentary rock is a clastic sedimentary rock that contains large round clasts. The round shape is as a result of several turning from some distance by running water or waves during weathering. From the explanation of the conglomerate sedimentary rock we can say option "A" is true because the rock has large clasts coming together to form the rock, option "D" is also true because of the round edge characteristics / properties of the clast.

7 0
3 years ago
Why do hot stars look bluer than cool stars?
Bezzdna [24]
As stars get older they get cooler and you know when you light a flame the part at the bottom is hotter so its also applies to stars, the star is very hot because it is newer and has more gas so it appears blue to us
7 0
3 years ago
Brief discussion on the annual rainfall graphs in South Africa (eight lines)​
otez555 [7]

South Africa is located in Africa and it is a relatively dry country, with an average annual rainfall of about 464 mm.

<h3>South Africa Seasons</h3>

There are four main seasons and they include the following:

  • Summer
  • Autumn
  • Winter
  • Spring

The annual rainfall graphs in the country is however very moderate which is characterized by sunlight and is the reason why it is among the dry countries on the African continent.

Read more about South Africa here brainly.com/question/26601432

4 0
2 years ago
Other questions:
  • Why do certain areas attract large population
    13·1 answer
  • Name the alpine country that is commonly associated with the manufacture of fine chocolates and precision watches.
    14·2 answers
  • The following set of coordinates most specifically represents which figure?
    15·1 answer
  • Someone who makes maps is also known as a(n) __________.
    8·2 answers
  • Analyze the map below and answer the question that follows.
    8·2 answers
  • What 1 and 2 and 1 and 11
    15·1 answer
  • Find WX.
    14·1 answer
  • What kind of rock is most abundant in arkansas today?.
    10·1 answer
  • All of the following are themes in European history except:
    11·1 answer
  • 5. Include interviews with community members Term Find people who know a lot about the community to interview. Examine and apply
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!