1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
5

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

TAG-3
​
Geography
1 answer:
Rina8888 [55]3 years ago
7 0

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

You might be interested in
Round the following numbers to the nearest hundredth place. (Decimal places
lara31 [8.8K]

Answer:

412.34

322.51

-236.66

Explanation:

u move the decimal point twice which represents hundred way from it initial state.

4 0
2 years ago
By what date dose NASA want to put people on the planet Mars bye?
Fofino [41]
By the mid 2030's.  You can find it on their website. 
7 0
3 years ago
PLEASE HELP!!
MrRissso [65]

Corporations are often accused of despoiling the environment in their quest for profit. Free enterprise is supposedly incompatible with environmental preservation so that government regulation is required.

Such thinking is the basis for current proposals to expand environmental regulation greatly. So many new controls have been proposed and enacted that the late economic journalist Warren Brookes once forecast that the U.S. Environmental Protection Agency (EPA) could well become "the most powerful government agency on earth, involved in massive levels of economic, social, scientific, and political spending and interference.

But if the profit motive is the primary cause of pollution, one would not expect to find much pollution in socialist countries, such as the former Soviet Union, China, and in the former Communist countries of Eastern and Central Europe. That is, in theory. In reality, exactly the opposite is true: The socialist world suffers from the worst pollution on earth. Could it be that free enterprise is not so incompatible with environmental protection after all?

8 0
3 years ago
Give three examples of mode of transportation
Serga [27]

Answer:

truck, ship, train and plane

Explanation:

4 0
2 years ago
Read 2 more answers
Imagine that you’re a geographer and an urban planner, and you’re helping to plan a new shopping mall for your town. You discove
vlabodo [156]

Answer:

In cities due to high population and presence of more services.

Explanation:

Most shopping malls are present on that location where human population is higher such as cities and towns because people are the customers who bought the products present in these malls. The owners of malls built malls in the cities due to the presence of high population of peoples in order to sale more products to the people and earn high profit. these malls also built in cities due to the presence of services such as electricity and water etc.

4 0
3 years ago
Other questions:
  • Which of the following crops is a major export of many islands in oceania?
    8·2 answers
  • Describe how a valley glacier forms. pls help i cant figure this out thanks.
    7·1 answer
  • What happens to the incoming solar radiation after it is reflected off the surface of the earth
    13·1 answer
  • An animal burrows through a rock, causing it to break. This is an example of _____.
    5·1 answer
  • Why do you think geographers divide the eastern U.S. into four subregions
    11·2 answers
  • Give one example of how humans can affect the biosphere. How might that impact the other spheres in the Earth system? 
    15·1 answer
  • Pls I need to do a paragraph,but I have no idea!!!pleeeasee guys help
    15·2 answers
  • The Dead Sea, which lies between Jordan and Israel, is one of the saltiest lakes on Earth. Suppose you are a geologist exploring
    10·1 answer
  • How many years will it take soil moisture to be renewed on earth?​
    5·1 answer
  • Which expression is equivalent to the given polynomial expression?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!