1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
5

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

TAG-3
​
Geography
1 answer:
Rina8888 [55]3 years ago
7 0

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

You might be interested in
Soil in The blue ridge is high in ___. Which is red in color
OleMash [197]

Answer:

loamy

Explanation:

8 0
3 years ago
Read 2 more answers
I need help with these two questions pls and thank you!!!
dlinn [17]

Answer:

to

Explanation:

hard thank you

6 0
3 years ago
Effect of solstice on the earth surface​
Naddika [18.5K]

Answer:

the solstice make day or night significance longer .The mast important thing that they do idps cause the seasons ,with the earth on its 23.5 degrees angle along with the sun and the rotation the earth this causes the seasons and the appropriate climate for human to live

7 0
3 years ago
Which open-ocean zone order shows decreasing temperature?
Lyrx [107]

Answer:

i want to know the same answer

Explanation:

4 0
2 years ago
Read 2 more answers
Help. Ill give brainliest.
jolli1 [7]
I wanna say D.

Sorry if I’m wrong:(
7 0
2 years ago
Read 2 more answers
Other questions:
  • A planet whose distance from the sun is 3 au would have an orbital period of how many earth-years?
    12·1 answer
  • As a religious faith, candomblé appropriates beliefs from both __________. A. African faiths and catholicism b. Hinduism and cat
    12·2 answers
  • What type of climate is California​
    15·1 answer
  • Over rocky surfaces with no plant cover, the potential evaporation is, then the actual evaporation A) equal to B) much greater t
    5·1 answer
  • Como Diseñar el instructivo​
    9·1 answer
  • All of the following are considered to be part of the biosphere, except __________.
    15·2 answers
  • __9. Critics of the desalination process argue that desalinated ocean water
    8·2 answers
  • You are required to conduct a research on the Amazon aka Earth's Lungs.
    7·1 answer
  • Which type of growth pattern is typical of cities that fit the model depicted?
    6·1 answer
  • Which of the following is a safety precaution to take in order to avoid wildlife?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!