1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
5

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

TAG-3
​
Geography
1 answer:
Rina8888 [55]3 years ago
7 0

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

You might be interested in
Which European colonial power took control of Malaya and built the port of Singapore
Marizza181 [45]
The United Kingdom is the answer :)
4 0
3 years ago
Magma
andreev551 [17]

A fact is a pragmatic truth, a statement that can, at least in theory, be checked and confirmed. Facts are often contrasted with opinions and beliefs, statements which are held to be true, but are not amenable to pragmatic confirmation.The word fact derives from the Latin Factum, and was first used in English with the same meaning: "a thing done or performed", a use that is now obsolete. The common usage of, "something that has really occurred or is the case", dates from the middle of the sixteenth century. Fact is sometimes used as synonymous with truth or reality, as distinguishable from conclusions or opinions. This use is found in such phrases Matter of fact, and "... not history, nor fact, but imagination."

6 0
3 years ago
What do the atmospheres of venus and mars teach us about our own atmosphere
WINSTONCH [101]
Earth’s atmosphere is a mixture of nitrogen (79%), oxygen (20%), and a small fraction of carbon dioxide, water vapours and other gases. This makes the existence of life possible on Earth. However, the atmospheres on Venus and Mars mainly consist of carbon dioxide. The amount of carbon dioxide on these planets can range from 95% to 97%. This may be the reason no life exists on these planets.

The atmosphere of Venus is about 96 per cent carbon dioxide, with surface temperatures around 737 K (464 °C, or 867 °F).
Venus itself rotates only once every 243 Earth days.
Mars, in contrast, has a thin atmosphere composed of about 95 per cent carbon dioxide, with the remainder being mostly diatomic nitrogen.
5 0
2 years ago
Why will no one help me :C I am gonna fail :c
PIT_PIT [208]

No one will help me either

7 0
3 years ago
Read 2 more answers
Where did the Yom Kippur War of the<br> 1970s take place?
galina1969 [7]

Answer:

Combatants: Israel, Egypt, Syria

End date: 25 October 1973

Date: 6

Explanation:

4 0
3 years ago
Other questions:
  • Which area of the U.S. is home to "tornado alley"?
    5·1 answer
  • Give two characteristics of an ocean trench.
    9·2 answers
  • Flvndflknvdfklnvdfklnvfdlknvfklnf
    11·1 answer
  • Religion, beliefs, and social norms can influence population distribution. Please select the best answer from the choices provid
    14·2 answers
  • What continent is 40 degree north and 20 degree east
    14·2 answers
  • (read the passage)THE FIRST FLAG: Betsy Ross made her living as a seamstress, and had many customers. She sewed many things, inc
    6·1 answer
  • What is the temperate evergreen forests?​
    15·1 answer
  • "You may not control all the events that happen to you, but you can decide not to be reduced by them."
    13·1 answer
  • Acobdarfq <br> who t-f is this du-m-b a-s-s
    12·2 answers
  • Write in short about any two types of wells and draw image of the same.​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!