1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
5

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

TAG-3
​
Geography
1 answer:
Rina8888 [55]3 years ago
7 0

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

You might be interested in
Should cars be banned down highstreets?
Troyanec [42]
I do not think so. what other technology could we use.
3 0
3 years ago
The capital of chile is santiago. true or false?
Kruka [31]
The capital of Chile is Santiago. "True."
5 0
4 years ago
Read 2 more answers
How is thermohaline circulation influenced by salinity and temperature? a. It is driven by density gradients, which are affected
adell [148]
The answer to your question is a
5 0
3 years ago
What content is Northeast of Africa?
marishachu [46]

Answer: Asia

I’m assuming you wanted the continent

Explanation:

8 0
4 years ago
Read 2 more answers
You are steaming across the Atlantic Ocean on a large cruise ship. What happens to your weight as the ship leaves the deep water
Scorpion4ik [409]

Answer:

The shallow water and proximity of the sides of the channel effects the ship navigating through the restricted waters. ... This decreases the upward pressure on the hull, making the ship sink deeper in the water than normal and slowing the vessel.

5 0
3 years ago
Other questions:
  • ¿Qué particularidades tiene el coronavirus en ámbito local y global?
    14·1 answer
  • Which primary subsistence crop is in danger due to soil erosion
    11·1 answer
  • Which geographical landform does a third of China's population live near?
    15·2 answers
  • Floors and walkways should be kept free of .
    12·2 answers
  • Ma ajutati si pe mine la un argument roulul din viata omului va rog frumos  de 20 -25 de randuri va rog frumos am nevoie maine l
    7·1 answer
  • Which of the following scenarios most likely qualifies as a human rights violation?
    9·1 answer
  • In recent years, the war on drugs has centered on the border between Mexico and the United States. Which of the following statem
    11·2 answers
  • Identify the First Nation to become independent from colonial rule
    7·2 answers
  • What are two seperate ways to how the Europeans affected the native population?
    9·1 answer
  • The countries with the lowest total GDP (national total) share what geographic characteristic?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!