1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
2 years ago
5

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

TAG-3
​
Geography
1 answer:
Rina8888 [55]2 years ago
7 0

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

You might be interested in
Cities have both negative and positive effects on the environment.
nevsk [136]

Answer:

Yes!

Explanation:

Here are some examples:

Some Positive Effects:

- Jobs (investment)

- Nourishment (food)

- Education

- Home and Residence

Some Negative Effects:

- Polution to the enviroment

- Upheaval rampage

3 0
2 years ago
What do plans make by using air ,water and energy from the sun
Readme [11.4K]

Answer:

They grow

Explanation:

they grow from air, water, energy and sun

6 0
2 years ago
Read 2 more answers
What countries border England?
bearhunter [10]
<span>The countries that border England are Wales and Scotland. Scotland to the north and Wales to the west.</span>
3 0
3 years ago
Read 2 more answers
URGENT! Look at the image of the water cycle. Imagine that a farm uses nitrogen based fertilizer to help grow their crops, and p
Temka [501]

Answer:

C

Explanation:

The run-off will absorb the fertilizer and it will contanimate the lake

5 0
3 years ago
The movement of a tectonic plate away from a mid-ocean ridge can be measured by the orientation of the _______ field.​
Crazy boy [7]

Answer:

geomagnetic field.

Explanation:

The earth magnetic field can be likened to a bar magnet with a North and South pole. It originates from the movement of molten iron and nickel in the outer core.

At every point in time, the magnetic field orientation can change. We must note that the magnetic north lies close to that of geographic north axis of the earth.

Around the mid-oceanic ridges, new materials are brought to the surface. These new materials can contain magnetic minerals such as haematite which are capable of being magnetized as a result of the prevalent magnetic field of the earth. As different materials are brought up, the magnetic minerals preserves the details of the magnetic field at that point in time. Using this information can know the orientation of the magnetic field at any point in time if the magnetic history chart of the earth is constructed. Oceanic ridges becomes older as they move away from the divergent margins.

7 0
3 years ago
Other questions:
  • Notre Dame Cathedral - Paris © 2012 Christopher Kramer Creative Commons, Attribution 2.0 Generic license This cathedral is built
    14·2 answers
  • Where is Japan located
    12·2 answers
  • What hotel in georgia have guests found copies of their wall street journal?
    5·1 answer
  • A detailed flow diagram for biomass energy
    15·1 answer
  • From a train station, one train heads north and another heads east. Some time later, the northbound train has traveled 16 miles.
    5·1 answer
  • Many North African Berbers learned Arabic in addition to traditional Berber languages in order to __________.
    6·1 answer
  • What can farmers do to protect their crops?
    15·2 answers
  • Which physical feature is in the eastern part of South America?
    13·2 answers
  • I just need a Desert data jam. my teacher explained how to do one but I got lots and have been caught up with work. Please help
    10·2 answers
  • What is the apparent relationship between a stream’s gradient and its sinuosity?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!