1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
5

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

TAG-3
​
Geography
1 answer:
Rina8888 [55]3 years ago
7 0

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

You might be interested in
Which process changed the shape of the rock layers over time??
Zigmanuir [339]

Answer: C

Explanation: Erosion is when something breaks up over a long period of time, specifically rocks. If something is breaking up the shape of it will change, thus the answer is C, erosion.

4 0
2 years ago
Read 2 more answers
How does manufacturing affect economic development?
Mandarinka [93]
Because those company’s are making all the things people want and need
3 0
2 years ago
What could be a major cause of an internal conflict ?(DOK 1)
jeka94
Forced assimilation could be a major cause of internal conflict
5 0
2 years ago
What natural boundary separates Asia from Europe?
yarga [219]
The modern convention of the Europe-Asia boundary (from south to north) follows the Aegean Sea<span>, the Dardanelles-Sea of Marmora-Bosporus, the </span>Black Sea<span>, along the watershed of the Greater Caucasus, the northwestern portion of the </span>Caspian Sea<span> and along the </span>Ural River<span> and </span><span>Ural Mountains

So I believe your answer would be the Aegean sea, Dardanelles sea, and the black sea.</span>
8 0
2 years ago
Qual a espessura da camada de ozonio
WINSTONCH [101]

Answer:

Localizada entre 15 e 35 quilômetros de altitude e com cerca de 10 km de espessura, contém aproximadamente 90% do ozônio atmosférico.

3 0
2 years ago
Other questions:
  • 18°C = _____<br><br> -255 K<br> 0 K<br> 18 K<br> 291 K
    6·2 answers
  • What factors promote and affect world trade
    10·2 answers
  • Which one of the following graphs shows a direct variation
    10·1 answer
  • If you are able to say that one rock is older or younger than another or one fossil is older or younger than another, what type
    6·1 answer
  • What state has a city named after thomas edison
    6·2 answers
  • How are bangkok and seattle similar. A.both have polution problems B. Both have effective mass transit systems C.both have very
    7·2 answers
  • "!PLEASE ANSWER!"
    10·1 answer
  • Describe how the Mongol empire was governed.
    15·1 answer
  • The rate of evaporation depends on four main factors: water body size, heat energy, atmospheric pressure and air movement. Warm
    7·1 answer
  • How was apartheid implemented
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!