1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
5

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

TAG-3
​
Geography
1 answer:
Rina8888 [55]3 years ago
7 0

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

You might be interested in
Why do you think someone like an essene would live strictly communal lives and sacrificed to be pure? What do you think it meant
Daniel [21]
You have to fit in in order to be in the group
5 0
3 years ago
Can someone please help me??? here's a picture.
Novay_Z [31]
There’s no picture.
8 0
3 years ago
What caused the increase in the number of latin america in the middle class in the late 19 century
exis [7]
One of the biggest reasons was that there were some revolutions that happened around the lat 19th century. They were primarily sparked by lower class individuals who were looking for more money to support themselves/families.
8 0
3 years ago
A circle has a diameter
torisob [31]

The circumference of circle is 20.096 units

<em><u>Solution:</u></em>

Given that circle has a diameter  with endpoints at (10, 8)  and (5, 4)

To get the diameter, find the distance between the end points

<em><u>The distance between two points is given by formula;</u></em>

d=\sqrt{\left(x_{2}-x_{1}\right)^{2}+\left(y_{2}-y_{1}\right)^{2}}

Here the points are (10, 8)  and (5, 4)

(x_1, y_1) = (10, 8)\\\\(x_2, y_2) = (5, 4)

Substituting the values we get,

\begin{aligned}&d=\sqrt{(5-10)^{2}+(4-8)^{2}}\\\\&d=\sqrt{(-5)^{2}+(-4)^{2}}=\sqrt{25+16}=\sqrt{41}\end{aligned}

d = \sqrt{41} = 6.4

Thus the diameter is 6.4 units

<em><u>The  circumference of the circle is given by formula:</u></em>

c = \pi d

Where "d" is the diameter of circle

c = 3.14 \times 6.4 = 20.096

Thus circumference of circle is 20.096 units

4 0
3 years ago
How can a region such as latin america still have large amounts of diversity?
Neko [114]
Nowadays, Latin America is on the spot light for International business. Several Latin American countries are becoming better off. Countries such as, Mexico, Chile, Brazil, Colombia and Peru are characterized by an economic boom, financial stability, trade liberalization, demographic shifts, and an expanding middle class society. Although poverty and inequality still prevail in the region, some of these countries are evolving and are no longer fundamentally poor. Better economic conditions, a huge market and an increasing talented labor force are presenting Latin America to the world as a land rich of business opportunities. In the past 4-5 years due to the European crisis and the slowdown of growth in The United States, several Latin American countries have become recipients of increasing Foreign Direct Investment. Not only that, but also, successful corporations in the region, known as Multilatinas, have expanded to other countries in the region and abroad. Time has arrived to understand better how to do business in the region and to identify how different this task could be, depending on the country.
7 0
3 years ago
Other questions:
  • What is a large crack in the earth formed by a river or earthquake?
    8·2 answers
  • Question:
    11·1 answer
  • Why does the leeward side of a mountain typically remain dry?
    15·1 answer
  • A geologist studies _____.
    6·2 answers
  • Wisconsin Senator Joseph McCarthy is noted for his actions during the early part of the Cold War. Who were the two MAIN particip
    14·1 answer
  • The president of Peru improved the economy, but resigned in 2000 because _____.
    7·2 answers
  • To what extent is climate change a natural process?
    5·1 answer
  • What map projection do nearly all seagoing navigators will use today
    15·1 answer
  • PLEASE HELP WILL MARK BRAINLIEST What effect might a water park might have on Dubai's water supply?
    6·1 answer
  • What is a difference between commercial and cottage industries?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!