1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
5

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

TAG-3
​
Geography
1 answer:
Rina8888 [55]3 years ago
7 0

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

You might be interested in
Which of the following best describes contemporary perspectives on resource sustainability?
Lelechka [254]

Answer:

all are correct my friend

4 0
3 years ago
How long does it take the earth to complete one orbit around the sun?.
ella [17]

Answer:

365 days

Explanation:

6 0
3 years ago
Read 2 more answers
Who produces most goods and services in the United States? (10 points)
GrogVix [38]

It l think it is. Private businesses



8 0
3 years ago
Read 2 more answers
Which characteristic is common to the 3 major religions practiced in the Middle East?
amm1812

Answer:

goog le

Explanation:

search on there

6 0
3 years ago
Read 2 more answers
How do soil regions influence human activities?<br><br>Help pleaseeeee
Juliette [100K]
Different soil regions influenced human activities because of the fertility of the soil. The more fertile the soil the more agriculture and more agricultural means more food.
4 0
3 years ago
Other questions:
  • Select all the items that describe choices
    13·2 answers
  • We can only see one side of the moon from the earth. true false
    12·2 answers
  • In the figure, mDE = 118° and mBC = 48°. The diagram is not drawn to scale.
    6·2 answers
  • What events are most likely to occur along a transform boundary?
    8·2 answers
  • What are the characteristic of a hunter-gatherer
    12·2 answers
  • I'm re-asking this question. How is birth rate an indicator of the quality of life?
    9·1 answer
  • The Aztec created floating platforms from which they grew crops called chinampas. The creation of Chinampas on Lake Texcoco woul
    9·1 answer
  • Permafrost and mosses, lichens, and wildflowers are common in the a. tundra climate. b. subtropical climate, c. temperate climat
    10·1 answer
  • Cite examples of changes brought about by a shift from rural to urban living.
    13·1 answer
  • True or False? The use of water has a direct impact on desertification.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!