1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
s2008m [1.1K]
3 years ago
10

A person with blood type AB has the alleles IA and IB. A person with blood type O has the alleles ii. Why is it impossible for a

person with blood type AB to have a child with blood type O?
: A person with blood type AB will give that same blood type to the child.

: The child can have O blood if he gets the ii genotype from the other parent.

: A child with blood type O has to have two different alleles for this blood type.

: A person with blood type AB will give a child either the IA or IB allele.
Biology
1 answer:
natka813 [3]3 years ago
8 0
It is impossible because the IA and IB are dominant alleles therefore always masking the recessive ii alleles for O blood type. The only way for a recessive trait to appear is if both parents at least are a carrier of said recessive allele.
You might be interested in
A new marine animal species has been discovered. Locomotion is via a muscular foot. Digestive, nervous, excretory, reproductive,
zzz [600]

Answer:

Mollusca Phylum

Gastropoda class

Explanation:

The Mollusca Phylum is one of the most noticeable phyla that includes a wide variety of forms.

The ancestral Mollusca used to habit the pre-cambric oceans. It was bilaterally symmetrical, with a well-defined head that had tentacles and ocellus. Its ventral surface was plane and muscular, shaping a reptant foot. The dorsal surface was protected with a convex and oval shell.

The Gastropoda class is the richest class among all mollusks. This class experienced a characteristic torsion in their shell. This twist also involved the visceral mass, the mantle, and the mantle cavity. But by the time that this torsion occurred, the shell had already experienced a turn into a coil shape, which was then followed by its torsion.

The typical gasteropod´s shell is a conical structure composed of several tubular spirals containing the individual´s visceral mass. The biggest spiral ends as an opening from which the head and the food protrude.

6 0
3 years ago
Read 2 more answers
Describe how the skin works when the place is very hot​
alina1380 [7]

Answer:

when body temperature rises, such as when exercising on a hot day, the dermal blood vessels will dilate, in the sweat glands begin to secrete more sweat. the invaporation of the sweat from the surface of the skin cools the body by dissipating heat.

Explanation:

Hope this helped Mark BRAINLEST!!!

4 0
2 years ago
Read 2 more answers
What is the complements the section of dna modeled above 3` AATCGC 5´
ANTONII [103]
Its the reverse
5'CGCTAA 3'
3'AATCGC 5'

7 0
2 years ago
Pls help I will mark bainiest. Answer first
never [62]
Topography is the answer :)
3 0
3 years ago
Read 2 more answers
Unlike exoskeletons, endoskeletons... A.protect the animal well, B.are relativity heavy,C.can grow as the animal grows, D.need t
inysia [295]
C is the answer to this
5 0
3 years ago
Read 2 more answers
Other questions:
  • What information can you obtain if you know a minerals use or chemical composition
    14·1 answer
  • What is a cell that has a nucleus surrounded by a membrane and many other specialized organelles?
    8·2 answers
  • Are humans autotrophs or heterotrophs ?explain why
    14·1 answer
  • Use the term "concentration" in a sentence about liquids that conveys its meaning. (9 points)
    10·2 answers
  • Brings dry, clear weather
    5·1 answer
  • Which method is used to get consumers to eat more?
    6·1 answer
  • PLSS Help
    6·1 answer
  • D. Which food molecule (carbohydrate, lipid, protein) would you eat if..
    9·1 answer
  • Once mRNA is made it travels
    9·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!