1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kkurt [141]
3 years ago
12

racoons are opportunistic feeders and will eat just about anything they can find. they will catch and eat invertebrates such as

beetles, but also eat different fruits and vegetables and other plant matter. Based on their feeding habits, they would be categorized as
Biology
1 answer:
Anna007 [38]3 years ago
6 0

Answer:

Explanation:

Based on their feeding habits, we will regard the raccoons as omnivores. Omnivores are organisms that possess the ability to feed and survive on both plant and animal matter.

These raccoons eat invertebrates etc which are animal matter and then different fruits and vegetables etc; plant matter.

Thus, they can be regardless as being an omnivore.

You might be interested in
In roots, ____ increase the surface area through which water and minerals can diffuse.
Ilya [14]
The answer is <span>root hairs</span>
8 0
3 years ago
A drug developed to treat diabetes may be effective in treating what other condition
aleksandrvk [35]
<span>Alzheimer's would also be what a diabetes medicine can help cure. Since the diabetes is a being able to maintain glucose it can also send signals to the brain which in term can help with dementia.</span>
4 0
4 years ago
Select the statement that is false. The sugar of RNA differs from the sugar of DNA. Three main types of RNA exist. If one side o
Cloud [144]
Three main types of rna exists is false
4 0
3 years ago
Read 2 more answers
39 Assume the ilghe wave directed at the paper is white light and the paper contains pigments that absorb the wavelerigens of
finlep [7]

Answer:

Black  

Explanation:

The paper absorbs light of all visible wavelengths.

No visible light is reflected.

The paper will appear black to human eyes.

3 0
3 years ago
After cheering wildly at an exciting football game your body may begin to relax on the way home. This relaxation reflects activi
siniylev [52]

Answer;

-Sympathetic nervous system

After cheering wildly at an exciting football game your body may begin to relax on the way home. This relaxation reflects activity of the sympathetic nervous system.

Explanation;

The sympathetic nervous system is part of the autonomic nervous system, which also includes the parasympathetic nervous system.

The sympathetic nervous system activates what is often termed the fight or flight response. Like other parts of the nervous system, the sympathetic nervous system operates through a series of interconnected neurons. Sympathetic neurons are frequently considered part of the peripheral nervous system (PNS), although there are many that lie within the central nervous system

7 0
3 years ago
Other questions:
  • Prokaryotes do not obtain organelles by endosymbiosis because they lack
    8·1 answer
  • Because of apoptosis, _________________________.
    5·1 answer
  • Which advancement in technology has helped cut down on waste?
    6·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Research data that is presented using descriptive language is said to be __________. A. quantitative B. qualitative C. experimen
    10·1 answer
  • What is the total amount of matter in an ecosystem doing
    13·2 answers
  • Depict the role of lysosomes within a cell, using the metaphor of a factory. Explain
    12·1 answer
  • SPRAWDZIAN Z BIOLOGII UKŁAD RUCHU BŁAGAM POMÓŻCIE
    6·2 answers
  • Which of the following shows the correct progression of organisms on the planet?
    14·1 answer
  • explain how natural selecin oacting on allele frequencies of a gene that controls body coloraiton can result in populations of 3
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!