1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
5

Which are the flowing are forms of a sexual reproudution

Biology
1 answer:
nexus9112 [7]3 years ago
8 0

allogamy, internal fertilization, external fertilization, autogamy.

You might be interested in
Food chains display organisms in order in order terms of energy flow. Each arrow in the food chain represents the
scoray [572]
B - energy flow from one tropic level to the next
5 0
3 years ago
Read 2 more answers
Inpropper fractions​
dexar [7]

Answer:

If you r asking WHAT an Improper fraction is  

Explanation:

An improper fraction is a fraction in which the numerator (top number) is greater than or equal to the denominator (bottom number). Fractions such as 65 or 114 are “improper”.

5 0
3 years ago
Read 2 more answers
In fruit flies, the allele for white eyes is recessive to the allele for red eyes. In a generation of fruit flies, 45 males with
podryga [215]
<span>heterozygous / homozygous refers to whether both alleles for a gene are the same. The organism is homozygous if both alleles are the same - that is, either both are dominant or both are recessive. The organism is heterozygous if the alleles are different - that is, if one allele is dominant and the other allele is recessive..
 the answer to the questions is A. </span><span>One parent was heterozygous for eye color and the other was homozygous with red eyes.</span>
7 0
2 years ago
Read 2 more answers
Barnacles attach to shellfish for transportation. The shellfish is not helped or harmed. This is an example of_
Vesna [10]

The correct answer is:

_________________________________________________

                       →    " commensalism" .

_________________________________________________

<u>Note</u>: "Commensalism" refers to a symbiotic relationship {"symbiosis"}  between two (2) organisms — in which one organism benefits and the other organism is neither helped nor harmed.  

              { i.e.  " +, 0 " ;  that is:  "plus" sign for "one organism benefits" ;

                       "zero" sign for "neutral" ;

                    (in that the other organism is neither helped nor harmed.}.

_________________________________________________

In the example given in the question, the two (2) organisms are:

 1)  the barnacles;  and:  2)  the shellfish.

       The barnacles benefits by given a place to attach for the purpose of transportation (by using the shellfish to "cling to"}.  

      The shellfish are neither helped (benefitted in anyways from the attachment from the barnacles— nor are the shellfish harmed in any way.

_________________________________________________

Hope this answer helps you!

     Best wishes in you academic pursuits

               — and within the "Brainly" community!

__________________________________________________

8 0
3 years ago
Is the circled karyotype a male or female?<br><br><br> female<br><br><br> male
Nitella [24]

Answer: A normal female karyotype is written 46, XX, and a normal male karyotype is written 46, XY.

Explanation:

3 0
2 years ago
Read 2 more answers
Other questions:
  • Only adult ticks of the genus Ixodes may feed on humansa. True b. False
    7·1 answer
  • What is a period with lower-than-average precipitation?
    14·1 answer
  • The hospice nurse is visiting the wife of a client who died 10 months ago. the wife states, "my life is meaningless since my hus
    9·1 answer
  • How do animal-like protists differ from plant-like protists?
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A good model of the cell membrane would be
    7·1 answer
  • What are the two ways macrophages are able to respond to invading germs?
    8·1 answer
  • ~iron ore ~granite ~limestone ~gravel The four items listed above are important resources in Minnesota. What do the four resourc
    10·1 answer
  • Beth broke her ankle bone. The doctor gives her a brochure on foods she can eat to help restore the
    8·1 answer
  • Are all animals that share a food source classified in the same trophic level
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!