Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end. 
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences. 
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted. 
I believe duplication is feasible since AATT sequences are repeated once. 
Our final answer,
 inversion and duplication occur here.
 
        
             
        
        
        
Look it up online, look up a copy of the Articles of confederation and fill it in! Best I can do for you my friend
        
                    
             
        
        
        
Inbreeding is increased due to the small number of individuals in the population. Selective breeding; > Humans can cause a decrease in genetic diversity too. ... > Selective breeding involves choosing which animals or plants to breed so that they have certain benefits.
        
             
        
        
        
Answer:
I think the answer is B. 
Explanation:
I think this because they have these variations to better adapt to conditions in their environments.