1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lapo4ka [179]
3 years ago
12

A scientist plans to find out if dams harm a river ecosystem. He interviews 500 enviormentalists and 450 of them believe dams ar

e harmful to the ecosystem. The scientists concludethat 90 percent of people believe that dams are harmful. Why is the scientist's comclusion most likely unrealible.
Biology
1 answer:
Triss [41]3 years ago
3 0

The answer is: the source of information could be biased

The scientist is interviewing environmentalists and then generalized their opinion as "people". An environmentalist is a person that cares about the environment, so they will more likely to deny the option that harms the environment. If the dam harmful to the environment, most environmentalists will not approve it.



You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Dr. mclear is a scientist studying heredity. she wants to isolate the basic unit for the transmission of heredity, which is a(n)
AlekseyPX
I believe the answer would be gene.
5 0
3 years ago
Need help fast!!!<br> please!! 20 POINTS
Vladimir79 [104]
Look it up online, look up a copy of the Articles of confederation and fill it in! Best I can do for you my friend
6 0
2 years ago
Read 2 more answers
How can selective breeding increase biodiversity within a species?
Softa [21]
Inbreeding is increased due to the small number of individuals in the population. Selective breeding; > Humans can cause a decrease in genetic diversity too. ... > Selective breeding involves choosing which animals or plants to breed so that they have certain benefits.
6 0
3 years ago
PLEASE HELP !! ILL GIVE BRAINLIEST *EXTRA 40 POINTS* DONT SKIP :(( .!
Naya [18.7K]

Answer:

I think the answer is B.

Explanation:

I think this because they have these variations to better adapt to conditions in their environments.

5 0
2 years ago
Read 2 more answers
Other questions:
  • Use the cellular diffusion lab to help you answer the two questions. There is a larger number of a hydrophilic molecules on the
    13·1 answer
  • How can we improve crop production​
    13·2 answers
  • Which phrase describes the chromosomes by the end of prophase of mitosis?
    9·2 answers
  • Identify the disorders described. immune system overreacts to an antigen part of the immune system does not function properly th
    9·2 answers
  • Suppose you have monohybrid snapdragons in your garden and you find that they produce red seeds to white seeds in the ratio of 3
    5·2 answers
  • What is the importance of hierarchy in classification ??
    9·1 answer
  • Many genes are involved in coat color and coat patterns in cats. The autosomal Dominant white (Wd ) allele results in pure-white
    15·1 answer
  • Proteins, carbohydrates, and fats are<br> through the pyruvate and acetyl CoA.
    5·1 answer
  • 3)What is the epiglottis?
    13·1 answer
  • why did the researchers add filtrate which macerated moss had been removed to control microcosms?(worth 5marks)​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!