1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hodyreva [135]
3 years ago
15

An organism has a haploid number of 8. what is the organism's diploid number

Biology
2 answers:
evablogger [386]3 years ago
7 0
If the haploid number is 8, would be, n = 8
assume a diploid species, normal body cells have 2n 0r 16 chromosomes in 8 pairs of 2.

2n = 8, 2(8) = 16

the number would be 16




hope that helps!!!
elixir [45]3 years ago
4 0

Answer:

16

Explanation:

apex

You might be interested in
Water is considered a _______ resource.
Tju [1.3M]

Answers/ Explanations:

- Water is considered a <u>'Natural'</u> resource (Fresh water is also considered a <u>'limited'</u> resource.

- Oil, coal, and natural gas are considered <u>'Non-renewable'</u> resources.

- <u>'Chemical'</u> energy is able to be replaced within the ecosystem for human use.

- A farmer who wants to produce the best crop yield will use '<u>Precision Farming.'</u>

- When a pollutant increases in concentration at higher levels of the trophic level, <u>'Biomagnification'</u> can harm organisms at the highest levels.

4 0
2 years ago
Read 2 more answers
If one sample food contains 200 cal in another contains 300 cal, which statement applies?
Advocard [28]

<u>Answer</u>:

The food containing 200 calorie have less potential energy than the food containing 300 calorie

<u>Explanation</u>:

The potential energy content of a food material is its stored energy content which is in the form of chemical bonds. This energy can be measured through the combustion of food material inside a calorimeter. A calorimeter is an instrument which is used to measure the total calorie content of the food or other biological samples by measuring its heat content. A Calorie is unit of energy which is in form of heat.

The food material containing carbohydrates proteins and fats have energy in form of chemical bonds.  On the breaking of bond inside the body, energy is released as in the case of glucose breakdown also known as glycolysis.  

The energy released from glycolysis is used to synthesize high energy containing phosphoanhydride bonds. These ATP molecules are a further breakdown in the system to provide energy to the cell to perform various activities.

6 0
3 years ago
Why do leaves on trees appear to be green?
kobusy [5.1K]
They appear to be green because of the chloroplast in the cells.
4 0
2 years ago
Please help me please help me ​
inessss [21]

Answer: The first answer is 3 and the second answer is c

Explanation:

6 0
2 years ago
When the protein gramicidin is integrated into a membrane, an H+ channel forms and the membrane becomes very permeable to proton
Naddika [18.5K]

Answer:

The electron transport chain may be defined as the sequential steps of the oxidation and reduction of the cytochromes. The electron transport chain is important for the production of ATP.

The gramicidn protein is an ionophoric antibiotic that can affect the electron transport system. The electron transport rate, oxygen uptake and proton pumping remains the same as more hydrogen ions will enter in the cell.  But the ATP synthesis rate might decrease and completely stop by using gramicidin.

8 0
3 years ago
Other questions:
  • ____ are fungi which obtain nourishment from decaying plants.
    9·2 answers
  • Help me
    15·1 answer
  • Provide an example of how cells balance the redox potential between different cellular components?
    6·1 answer
  • What is the primordial soup?
    8·1 answer
  • Which of these are the two major sources of nitrate pollution in rivers? the burning of fossil fuels by factories and cars anima
    12·1 answer
  • Suppose you try to heat your house using a fireplace in one of the rooms. Would a fan be helpful?
    11·2 answers
  • PLEASE HELP I WILL GIVE 50 POINTS!!!!! (btw its science not biology)
    7·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Identify the organelles in the cell to the right.
    8·1 answer
  • 6. When a mutation causes a genotype change in offspring, the mutation most likely occurred in which type of cell
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!