1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faust18 [17]
3 years ago
10

In the sanger (dideoxy) method for dna sequencing, a small amount of a dideoxynucle- otide triphosphate—say, ddctp—is added to t

he sequencing reaction along with a larger amount of the corresponding dctp. what result would be observed if the dctp were omitted?
Biology
2 answers:
Ugo [173]3 years ago
7 0
When the first G residue is encounteredin the template, ddCTP is added and polymerization halts. Only one band will appear in the<span>sequencing gel.

Hope this helps !

Photon</span>
n200080 [17]3 years ago
5 0

I agree with photon, if you have any trouble, maybe you can visit the site below.

https://www.cd-genomics.com/complete-plasmid-dna-sequencing.html

You might be interested in
What is the impact on human health as we try to stay ahead of the evolutionary process?
nignag [31]

The impact on the human health as we try to stay ahead of the evolutionary process is actually very bad. It is a fact that the humans are living much longer nowadays than ever before, with the main reasons for that being the well developed medicine and healthcare, much better standard of living, and having less riskier jobs. On the other hand, the human health, without being treated, is actually at an all time low. The immune system is much weaker than it has been, with the main reason being the isolation of the outside world and the higher level of hygiene. The allergies are becoming an ever growing problem because of this, as the immune system doesn't even recognize certain outside bodies are they an enemies or not. The constant radiation for numerous sources has caused development of numerous diseases. The old age has increased the percentage of diseases such as cancer, Alzheimer, Parkinson, or sclerosis. The less active life-style and food over saturated with fats and sugars has caused numerous health problems as well. All in all, the human health has become dependent on the pharmacy and its products, and without it it will suffer badly.

6 0
3 years ago
Organisms classified into the Protist Kingdom have<br> what type of cells
tatuchka [14]
Sorry if this isn’t right but I believe it’s Protista
4 0
3 years ago
Read 2 more answers
Consider two mammalian cells, one in G1 and the other in G0 (stationary) phase. If they are stimulated to pass the restriction p
tankabanditka [31]

Answer:

In the mentioned case, both the cells will start to perform replication of their DNA. In the case of G0, that is, the stationary phase, the mammalian cell can pass the restriction point with the supplementation of extracellular proliferation signal. While in the case of G1, which actually does not require any kind of external proliferation signal, as once the cell is in G1 phase, it is ready to go get the next phase. However, both the mammalian cells will cease or halt at G2 checkpoint.

3 0
3 years ago
If shells bones and cartilage are usually fossilized what environment might they have lived in before becoming a fossil?
vampirchik [111]

Answer:

Fossils are the preserved remains of plants and animals whose bodies were buried in sediments, such as sand and mud, under ancient seas, lakes and rivers. .

8 0
2 years ago
Read 2 more answers
What carries nutrients and oxygen from the mother to the fetus.
enot [183]
A. umbilical cord is the answer
4 0
3 years ago
Read 2 more answers
Other questions:
  • A researcher observed a reduction in the number of chromosomes during cell division for a microbe, he concludes that the microbe
    12·1 answer
  • What is activation energy?
    7·2 answers
  • Multicellular organisms _____ genetic information and mix the information from both parents
    13·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What are proteins, carbohydrates, and lipids composed of?
    7·1 answer
  • How many years does it take for the sun to pass the earth
    9·1 answer
  • Need help with lining up mutated DNA sequence
    8·1 answer
  • Which Two process is it Giving brainliest Please explain
    10·1 answer
  • A student has gone into cardiac arrest, meaning her heart has stopped beating. What would be the consequence for her
    12·2 answers
  • What s the function of the cell wall ?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!