1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wlad13 [49]
3 years ago
11

Scientific hypotheses are most often tested by the process of

Biology
1 answer:
Grace [21]3 years ago
6 0
Scientific method is the answer because it requires many step and each step is a step closer to your answer
You might be interested in
Do you know why bacterium plasmids are used for gene cloning but retroviruses are used for gene therapy when they both just modi
Rudik [331]

Answer:

Yes

Explanation:

The goal of cancer gene therapy is to introduce new genetic material into target cells without toxicity to non-target tissues.The patient with recurrent or metastastic cancer is often considered incurable. A variety of chemotherapeutic agents has been used alone, and in combination, for the treatment of recurrent oral squamous cell carcinoma. However, chemotherapy is associated with well-known toxicities and has demonstrated no clear impact on survival in patients with recurrent oral cancer. Local and regional disease control is paramount, underscoring an urgent need for more effective therapies. Gene therapy has the potential to target cancer cells while sparing normal tissues. Such a strategy may be useful for recurrent disease as well as in the adjuvant setting (i.e., at the resected tumor margins).

Although gene therapy as a treatment for disease holds great promise, progress in developing effective clinical protocols has been slow. The problem lies in the development of safe and efficient gene-delivery systems. This review will evaluate the problems and the potential solutions in this new field of medicine.

8 0
3 years ago
What process causes bread to rise...
ziro4ka [17]
A. alcoholic fermentation

the dough rises when bread is baked because of the yeast in it. the yeast uses glycolysis and alcohol fermentation to break down sugars in the dough. the yeast releases alcohol and carbon dioxide as a waste product. the carbon dioxide gas causes the bread to rise.
5 0
4 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Next in abundance of the organs composing the lymphatic system are the they are found throughout the body along the course of th
Dmitry_Shevchenko [17]
<span>Lymph nodes are abundant organs comprising a major part of the lymphatic system, and can indeed be found throughout the body, connected by the lymphatic vessels. However, the highest concentration of clustering occurs within in the inguinal region, cervical region, and axillary region.</span>
3 0
3 years ago
What kind of animals are best suited to life at the north pole? pick one
Helen [10]
Animals- that have thick layer of blubber or fur

is the correct answer......



HOPE IT HELPS YOU '_'
4 0
3 years ago
Read 2 more answers
Other questions:
  • Identify each adaptation as structural or behavioral adaptations.
    11·2 answers
  • A man's body washes up on a Florida beach. Some teen-agers find the body as they are walking along the beach. There doesn't seem
    10·1 answer
  • What is the independent variable in farmer browns experiments
    9·1 answer
  • In a species interaction when one species benefits while the other is harmed, such relationship is called
    8·1 answer
  • If a Pacemaker is not placed in a patient, what does the heart do to compensate for that loss?
    15·2 answers
  • What are the 2 parts of mitochondria
    13·2 answers
  • Cells store most of their chemical energy in the form of what?
    12·1 answer
  • Each chromosome contains thousands of genes. Each gene contains the
    6·1 answer
  • You have more ______ cells in your body than you have human cells.
    7·2 answers
  • Question 2 of 25
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!