1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRa [10]
3 years ago
10

......................

Geography
1 answer:
DIA [1.3K]3 years ago
6 0
......................
You might be interested in
Describe precautionary measures for Mozambique when a tropical cyclone is approaching
Taya2010 [7]
Tropical cyclone is a natural phenomenon that everyone has nothing to do in order to stop it but rather take precautionary measure before it approaches. (1) In Mozambique, if you are planning to go out, remember there is a tropical cyclone that is coming. Listen to radio and TV broadcasts or browse over the internet information regarding the cyclone. (2) Secure those loose objects. Try to stock food that is good for 3 days for the whole family. (3) Keep indoor.
8 0
3 years ago
WRITE A PARAGRAPH (minimum of 5 SENTENCES) EXPLAINING
spayn [35]

Answer:

Explanation:

hi

5 0
2 years ago
What is the name of the japanese island on which kobe is situated?
Alekssandra [29.7K]
The name of the island is honshu
7 0
3 years ago
What is a interesting stat/figure in this graph and what is the bottom line? (conclusion.)​
DerKrebs [107]

Answer:

It is a pie chart.

Explanation:

This means Canada uses mostly natural gas as energy

5 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • Geologic time is divided into segments based on two kinds of information. What are they?
    8·2 answers
  • What kind of sirenian is found in florida??
    7·1 answer
  • Which ocean is the largest in area​
    6·2 answers
  • Located near Africa’s coasts and rifts, __________ are steep slopes and cliffsides that are caused by erosion.
    9·1 answer
  • Where can the majority of earths freshwater be found
    9·2 answers
  • Four groups of students, in different parts of the world, are investigating the reason why the shape of the moon changes from ti
    10·1 answer
  • The image shows a type of fault.
    13·2 answers
  • Which of the following is a negative features of a free-market system?
    13·1 answer
  • Which blog statement is an example of a claim? Elbow Lake is home to freshwater fish such as sunfish, perch, and trout. Elbow La
    10·2 answers
  • Prompt
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!