Answer:
Geomorphology, as a critical component of physical geography, is needed to understand natural landform changes and potential hazards for populations.
Explanation:
I hope you understand
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Ocean ridge does not accompany volcanic activity in the Pacific Northwest.
<u>Explanation:</u>
In this process the denser oceanic plate force the thinner continental plate to sink into the mantle. This region is referred as subduction zone, where it results in intense volcanic eruptions and earthquakes.
The denser Pacific plate sinks because of the chunk pull impact and it likewise prompts the development of mountains. This sort of impact creates profound center seismic tremors.
It isn't related with the maritime edge as the mid-maritime edge shapes in a disparate plate limit. In the Pacific Northwest , the volcanic activity is carried out by the geological process majorly by subduction.
As I said in your other post/question on the same topic, you have to rephrase your question in order for us to help you. =)
a large planet of relatively low density consisting predominantly of hydrogen and helium, such as Jupiter, Saturn, Uranus, or Neptune.
