1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Art [367]
3 years ago
10

What causes the marbling effect in Indian corn?

Biology
1 answer:
ipn [44]3 years ago
7 0
The reddish streaks on these corn grains are caused by transposons. ... For example, if the transposon moves to a position adjacent to a pigment-producing gene, the cells are unable to produce the purple pigment.
You might be interested in
Why are viruses considered to be nonliving?
Sonja [21]

Answer:

C. they cannot live outside a host

Explanation:

Hope this helsp :))

8 0
2 years ago
Read 2 more answers
In human development, which of these must be present before tissue if formed?
Phoenix [80]

organ system must be present

8 0
3 years ago
What goes into the cell for cr to occur
BARSIC [14]
<span>In the presence of oxygen, one glucose molecule has the energy to make up to 38 ATP. The ATP production is determined by the following steps, (-2 ATP) glycolysis preparatory phase, (7-9 ATP) glycolysis pay-off phase, (5 ATP) oxidative decarboxylation of pyruvate and (20 ATP) Krebs cycle. One glucose which has 38 ATP hence was the summation of all the process mentioned that took place.  All these process take place under the cellular function of cellular respiration.<span>
</span></span>
6 0
2 years ago
The fissure in the brain that separates the two cerebral hemispheres is called the
poizon [28]
The Corpus Callosum seperates the brains right and left hemispheres.
8 0
2 years ago
At the end of DNA replication, each of the two new DNA molecules is composed of which of the following? *
dybincka [34]

Answer:

B

(The result of DNA replication is two DNA molecules consisting of one new and one old chain of nucleotides. This is why DNA replication is described as semi-conservative, half of the chain is part of the original DNA molecule, half is brand new.)

4 0
2 years ago
Other questions:
  • &gt; Question 4 How much does a 2-liter bottle of Sprite weigh?
    9·1 answer
  • In the chemical process of photosynthesis water is a
    9·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Where is a suitable place for getting tested for a sexually transmitted infection (STI)?​
    13·2 answers
  • Please answer all. Worth 50 points. Will mark you Brainliest if you answer all (as well as you can), for an extra 25 points!
    9·1 answer
  • Why are bacteria well suited to produce useful substances as a result of biotechnology?
    11·2 answers
  • Guys I need help asap.. it's due at 3:00
    6·1 answer
  • With an open posture, what could the body language of both parties look like?
    12·1 answer
  • Which respiratory substrate has a respiratory quotient of 0.5​
    11·1 answer
  • What organisms break down chemical wastes
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!