1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masteriza [31]
3 years ago
10

The analysis of total microbial genomes in an environment is called _________________________and the total microbial genomes in

an environment (or the total microbial community itself) is called a ____________________________. (When typing your two answers, separate them with a comma and space.)
Biology
1 answer:
Levart [38]3 years ago
5 0

The analysis of total microbial genomes in an environment is called metagenomics and the total microbial genomes in an environment (or the total microbial community itself) is called a microbiome.

<h3><u>Explanation:</u></h3>

The study that is associated with the genetic materials that are obtained directly form the sample in an environment refers to the term Meta genomics or  ecogenomics or community genomics. It can be considered as the process through which the  meta genome is produced.

The genetic material of the microbes such as  fungi, bacteria, viruses and protozoa refers to microbiome. These microbes lives inside the body of humans. The weight may range upto 5 pounds for these microbiomes. Micorbiomes are the total number of micro genomes that are present in the environment.

You might be interested in
Which type of point mutations can cause the MOST change in the amino acids?
kirill [66]
2. Insertion
would cause a frame shift in the polypeptide chain and potentially cause a stop codon.
6 0
3 years ago
During which process is energy released 1. external respiration 2. internal respiration
yarga [219]

Answer:

Internal

Explanation:

During cellular respiration, glucose is broken down in the presence of oxygen to produce carbon dioxide and water. Energy released during the reaction is captured by the energy-carrying molecule ATP.

5 0
3 years ago
Which characteristic would be most important when a scientist needs to study the changes in climate conditions over a five-year
alekssr [168]

Answer:



ExplanA. curious B. observant C. ethical D. creative

✓ Bation:

6 0
3 years ago
What is the main difference between cytokinesis in plants and animals?
Leni [432]
In plants it's identical.. ND in animals it's genetically unique
6 0
3 years ago
Darla has two different alleles of a gene that controls hair color. She must be _______ for the hair color trait. heterogenous h
zaharov [31]
The answer is heterozygous. It means that she has two different alleles for one specific gene. And homozygous means that it has two same alleles for one specific gene. Heterogenous/homogenous means the different or same between organisms.
4 0
3 years ago
Other questions:
  • Bacteria consist of a single cell and have no nucleus. What are bacteria called? A. Organelles B. Multicellular C. Eukaryotes AN
    5·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • I need Predator and Prey population lab answer?
    10·1 answer
  • A puggle is a type of dog first produced by mating two other types of dog a pug and a beagle what is that process
    9·1 answer
  • the enzyme catalase will break down hydrogen peroxide into oxygen and water. why doesn't catalase work on protein?please Be spec
    10·1 answer
  • If there are 12 chromosomes in an animal cell in the G 1 stage of the cell cycle, what is the diploid number of chromosomes for
    7·1 answer
  • What affect will adding sugar have on the viscosity of water
    8·1 answer
  • What is the definition of permeability
    12·1 answer
  • While their unique evolutionary paths have led to different adaptations, non-vascular and vascular plants are commonly found occ
    7·1 answer
  • Most meteoroids burn up in this layer
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!