1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inn [45]
3 years ago
6

What could be a result of an injury to the dorsal column?

Biology
1 answer:
Alik [6]3 years ago
8 0

loss of sensation to pressure and touch

Answer is 1

You might be interested in
2 reasons why someone might selectively breed cats<br><br> Other then to stop allergies
ivanzaharov [21]

Answer:

Explanation:

U might selectively breed cats for desired characterisitcs like having a cat with less fur or a cat with a certain type of colour.

8 0
2 years ago
How does overtillage harm soil? a. Overtillage can increase the rate of humus decomposition. b. Overtillage can increase the wat
MrRa [10]
<span><span>This is your answerOvertillage can increase the rate of humus decomposition.</span></span>
5 0
3 years ago
Read 2 more answers
3. Describe the mechanisms by which restrictive lung diseases reduce lung function and describe an example
Ivan

The mechanisms by which restrictive lung diseases reduce lung function is increasing shortness of breath, chronic cough, weight loss, and fatigue.

<h3>How does the breathing process work?</h3>

Pulmonary ventilation consists of the flow of air into and out of the lungs with each cycle, which is composed of inspiration and expiration; it is a what they run on is the process of running the resources.

The respiratory pattern of individuals with restrictive diseases is a higher respiratory rate and lower tidal volume. of the airways, that is, they have a smaller radius. The faster the flow, the greater the friction of the molecules with the airways, further increasing the resistance.

See more about restrictive lung diseases at brainly.com/question/13047253

#SPJ1

7 0
2 years ago
As per the rules of binomial nomenclature, which species name is written correctly?
Illusion [34]
B. <em>Pelecinus polyturator
</em>
When writing the scientific names of organisms, the entire name is italicized. Moreover, the genus name is written first and the first letter of the genus name is capitalized. The specific name is written after a space after the genus name.
4 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Atrial natriuretic peptide (anp) is a hormone that is made in the atria of the heart. the influence of this hormone is to ______
    12·1 answer
  • An arrangement of fascicles in concentric rings is called
    10·2 answers
  • What are the functions of Proteins?
    11·1 answer
  • What element are diatomics
    9·2 answers
  • a. An organism gets carbon by using carbon dioxide in the atmosphere to make sugar molecules. b. This organism is a An organism
    10·1 answer
  • What part of the male urogenital tract is shared by the urinary and reproductive systems?
    14·1 answer
  • 1. What bone is shown with letter Q?<br> Radius<br> Femur<br> Ulna
    9·1 answer
  • What is the main source of raw material for the production of plastics?​
    7·1 answer
  • Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the
    13·2 answers
  • What are 3 examples of how enzymes work
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!