1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Damm [24]
3 years ago
8

You and other scientists have been able to get the same results after many experiments. What is this proven data called?

Biology
1 answer:
zimovet [89]3 years ago
4 0
Proven data is called facts.
You might be interested in
This biome is filled with large hardwood trees
JulijaS [17]

Answer:

b Taiga

Explanation:

5 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Fill in the blanks:1. The liquid portion of your blood is called _________. 2. Erythrocytes, also called _________, are packed w
kvv77 [185]

Answer:

Explanation:

1. Blood Plasma: this is made up óf water, salts and protein. And it makes up more than half of the total volume of blood

2. Erythrocytes are also known as the red blood cells which makes up some of the solid part of the blood. They are packed with haemoglobin which helps to carry oxygen and they also gives blood the characteristics red color

3. These are also called white blood cells that function in producing antibodies that fights infection. Some types are monocytes, neutrophils, eosinophils etc.

4. Blood platelets: these also make up a part of the solid portion of the blood. They aid in blood clotting preventing blood loss.

8 0
3 years ago
Birds of a species have different sized and shaped beaks. What is this an example of? survival of fit individuals variation over
marysya [2.9K]

Answer:

I did this question for a science quiz and the answer is variation trust me I doubled checked on my quiz.

Explanation

6 0
3 years ago
Read 2 more answers
Biology - year 8 Hey pls help me with the questions below
tatiyna

Answer:

1. plant use sunlight , carbon dioxide,water. 2. Gulcose and oxygen

4.a)xylem b)phloem

6.leaves

8.roots,stems,flowers,leaves

4 0
3 years ago
Other questions:
  • I am a relatively fast-acting chemical messenger that affects mood, hunger, sleep, and arousal. what am i?
    8·1 answer
  • Adrian is recovering from schizophrenia. She has been taking high doses of antipsychotic medications for a very long period of t
    13·2 answers
  • Most amphibians have an aquatic larval form with _____ and a terrestrial adult form with _____.
    6·1 answer
  • What is your favorite type of animal ? (I'm board)<br> I like dogs wby
    5·2 answers
  • Large shrubs and trees are often planted near rivers to help prevent flooding. The deep, highly-absorbent roots of these shrubs
    11·2 answers
  • I GOVE BRAINLIEST!!!
    15·2 answers
  • Help anyone ?!! need answered
    8·1 answer
  • 6. One of the bacteria in Model 1 has a tail-like structure.
    13·1 answer
  • *Golden Rice is an example of what?*
    12·1 answer
  • Which of these physical structures in animals is similar to this structure in plants?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!