1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Romashka [77]
3 years ago
15

Which one of the following steps would be included in the primary response in humoral immunity?

Biology
1 answer:
Iteru [2.4K]3 years ago
5 0
<span>The answer is letter A.

Humoral immunity is a situation in which antigen binds to antibodies. It is also called as the anitbody-mediated beta cellularis immune system that is found in the extracellular fluids (e.g. antibodies, complement proteins, antimicrobial peptides. Humoral immunity is mediated by macromolecules and is so named because it can be found in the humours or body fluids. <span>
</span></span>
You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Crystalline
bekas [8.4K]
The organ that has all of those parts is the human eye.
3 0
3 years ago
In a lysogenic infection, once the dna of the virus is incorporated into the bacterial dna, the dna is called a
Alexeev081 [22]
This is called a prophage.
6 0
3 years ago
This series of diagrams represent the steps of mitosis. Label each diagram and describe what occurs during each step
ElenaW [278]
Each of the problem numbers.

4 0
3 years ago
In the presence of a non-competitive inhibitor a Lineweaver-Burk plot has a higher y-intercept than a control (without any inhib
konstantin123 [22]

Answer:

The Lineweaver- Burk plot is representation of Lineweaver-Burk equation of enzyme kinetics in graphical plot that is presented by the Hans Lineweaver and Dean Burk.

In the presence of a non competitive inhibitor shows higher y-intercept than a control in absence of any inhibitor whereas the x intercept is the same as the control that suggests or tells that maximum enzyme activity of the reaction is decreased, Higher Y intercept than controls means that it is same as 1/Vmax. The X intercept indicates that there is no effect on Km of the enzyme reaction.

4 0
3 years ago
Other questions:
  • Which temperature on the Celsius scale corresponds to 257 K on the Kelvin scale? K = °C + 273 A) -16 °C B) -26 °C C) 273 °C D) 5
    7·2 answers
  • If a company developed a way to modify a person’s DNA to guarantee certain attributes in offspring, should that company be force
    7·2 answers
  • Which letter indicates the wavelength of the wave?
    12·1 answer
  • Can abiotic factors be composed of cells?
    14·2 answers
  • If a single mutation turns off the growth of some pairs of legs within an organism, what's most likely affected?
    12·1 answer
  • Select two items that biologists agree are necessary in order to consider an organism “alive.” For each, give an example of a no
    15·1 answer
  • What does a tortoise covering body do for it?​
    8·1 answer
  • The era and the period ?<br><br> The supercontinent Pangaea was formed
    13·1 answer
  • Functions of chlamydomonas​
    12·1 answer
  • What is the function of chloroplast?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!