1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
3 years ago
8

A single pair of goldfish in an aquarium produced a large number of offspring. These offspring showed variations in body shape a

nd coloration. The most likely explanation for these variations is that the …
offspring were adapting to different environments


offspring were produced from different combinations of genes


parent fish had not been exposed to mutagenic agents
Biology
1 answer:
vagabundo [1.1K]3 years ago
4 0
The most likely explanation for the variation is the offspring were produced from different combination of genes. A single pair of gold fish mentioned in the question means a male and a female gold fish. The two of them mated and contributed different genes to the fertilized fish eggs, this results in production of various body shape and colouration which is known as variation.
You might be interested in
Which is a negative consequence of using DNA technology in forensics?
Fittoniya [83]

Answer:

hope that helps!!!!!!!!!!!!!!!!!!!!

7 0
2 years ago
Read 2 more answers
What is “the balance of nature?” Please answer in 1-2 simple sentences Thank You!!
AnnZ [28]

Answer:

The balance of nature is a theory that proposes that ecological systems are usually in a stable equilibrium or homeostasis, which is to say that a small change will be corrected by some negative feedback that will bring the parameter back to its original "point of balance" with the rest of the system

Explanation:

6 0
2 years ago
When researchers are interested in studying questions, such as "What do infants really understand about the world?" and "How do
zepelin [54]
It’s D, cognitive. Cognitive development has to do with the mind.
4 0
3 years ago
How do birds help the plant seen here reproduce?
frez [133]

Answer: Option A

Explanation:

Birds attach the bur of the plant which helps in the pollination. The birds sit on the plant and the burs of the plant gets attached in the legs of the birds which is transferred from one place to another.

Seeds at a different place will help in reproduction and growth of the plants. In this case the birds are carrier of the burs.

This is how the birds help in the reproduction of the plants by becoming the messenger.

4 0
3 years ago
BRAINLYIST PLEASEEEEEEE
photoshop1234 [79]

Answer: oil and vinegar salad dressing

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • If all living things are related then where did all their differences come from?
    15·1 answer
  • Which organelle is most prominent in the cells and makes protein synthesis?
    13·1 answer
  • updraft and downdraft in large cumulonimbus clouds can recirculate water molecules within the cloud and contribute to the format
    15·1 answer
  • PLEASE HELP You must design a valid experiment to show that there are microorganisms in the air. What would be your dependent va
    9·1 answer
  • Blood leaving the heart for the body passes through a large blood vessel is called the
    10·1 answer
  • Studying the differences between fossils and modern organisms, like the camel, helps scientists better understand the
    11·1 answer
  • Linnaeus recognized two kingdoms of living things, plants and animals. Why do today's
    7·1 answer
  • Help please someone please what is the answer
    8·2 answers
  • Describe: UAG (as well as UAA and UGA) is an example of a stop codon. Molecules called release factors bind to stop codons. Plac
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!