1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qwelly [4]
3 years ago
8

What describes the movement of individuals out of a population?

Geography
1 answer:
Delicious77 [7]3 years ago
5 0
Migration is ur answer
You might be interested in
Where is the most accumulation of glacial ice found?
dezoksy [38]

The answer for sure is A arctic circle

3 0
3 years ago
Read 2 more answers
The distance from Alexandria to Syene is about 500 miles. On the summer solstice the sun is directly overhead at noon in Syene.
svp [43]

Answer:

Earth circumference is 25000 miles

correct option is 25,000 miles

Explanation:

we have given here Alexandria to Syene distance = 500 miles

the sun is 1/50th of the circumference of the sky (about 7°)

as we know that Earth circumference done by astronomer Eratosthenes in 240 B.C

He observe on a particular time of day ( in noon) during the summer solstice

and there was no shadow in Syene in Egypt so  This was verified that the sun must be directly on overhead and not at an angle to the surface of the city at that time

so

In Alexandria he measured the position of sun at the same time and found it to be nearly (1/50)th of a complete circle

it would be 7.2 degree (when we do \frac{360}{50} = 7.2)

so 2 reference points being 2 cities for the sun

all measure circumference =  the distance between these two cities × 50  

and we have given 500 miles

so

Earth circumference = 500 × 50

Earth circumference is 25000 miles

correct option is 25,000 miles

4 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Wanna ft lend me your g mail and we can
salantis [7]

Answer:

YESSSSS WHATS URSS

Explanation:

3 0
2 years ago
Very similar fossils have been found in rock masses that are separated by oceans and thousands of miles. For example, the fossil
alisha [4.7K]

Answer:

The countries once were joined in one piece called Pangaea. Animals lived ON the pate boundaries of Pangaea. The plates then moved apart.

Explanation:

4 0
2 years ago
Other questions:
  • Hoyt's theory of urban land use and development emerged in response to changes in __________. A. agriculture B. transportation C
    10·2 answers
  • An astronaut is a short distance away from her space station without a tether rope. she has a large wrench. part a what should s
    11·1 answer
  • QUESTION 1 Environmental geology is a the study of the Earth's past history O the study of human interactions with the Earth C.
    8·1 answer
  • The spinning wheel became a symbol of national pride because _____.
    6·2 answers
  • -. Segments of mid-ocean ridges are sometimes separated by transform faults.<br><br> true or false
    11·1 answer
  • Distinguish between grid and arbitrary<br> grid system
    8·2 answers
  • Which of the following natural resources would be mined?
    10·1 answer
  • Pls don't answer with random letters. <br>how can a human modify a physical landform?
    11·1 answer
  • Which landform is the llano estacado a part of?
    5·1 answer
  • CONCLUSION: To accurately create a topographic map, what types of data do you need to collect?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!