The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
Answer:
Ventral. The ventral cavity, the interior space in the front of the body, contains many different organ systems. The organs within the ventral cavity are also called viscera. The ventral cavity has anterior and posterior portions divided by the diaphragm, a sheet of skeletal muscle found beneath the lungs
Explanation:
Can you show us the picture or sum
That's because the anoles are an extraordinary example of convergent evolution—where different living things independently acquire the same adaptations to the same challenges. For example, each island has an anole that lives among twigs.
