1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetradugi [14.3K]
3 years ago
14

What type of molecule is estrogen made of​

Biology
2 answers:
Citrus2011 [14]3 years ago
8 0
Hope this helps!

Estrogen is made out of steroid hormones

Alexeev081 [22]3 years ago
4 0

Answer:

Explanation: Estrogen are steroid hormones which are made up of special molecules with a four ringed carbon atom back bone. A series of chemical reaction occurs spurred by an enzyme which removes and add groups to cholesterol core. This action transforms it into pregnenolone and then into androgens, then special aromatase enzyme convert androgen into estrogen.

You might be interested in
1) Which would be considered an ecosystem?
aev [14]
Bacteria living in a deep ocean vent I think
5 0
3 years ago
If a 100-pound person played tug of war with a 50-pound dog , how light difference forces affect the results?
Anika [276]

Answer: APPARENTLY YOU CAN battle a lion at the San Antonio Zoo. OK, it's not that kind of battle—it's a tug of war battle. There is a thick rope passing through a hole. On one end, there is a lion cub. On the other end of the rope there could be three professional WWE wrestlers. Who wins? Well, the wrestlers don't win. But there is also some physics here.

It's all about friction

A typical tug of war isn't really about strength—it's about friction. It doesn't matter how strong you are if you don't have enough friction to keep yourself from sliding. Let me show you. Here is a force diagram for two people in a tug of war.

Each puller (person pulling on the rope) has essentially four forces acting on them. There is the downward weight which is balanced by the upward push of the ground. Since the person pulls on the rope, the rope pulls on the person in the opposite direction (this because of the two-ended nature of forces). Finally, there is the frictional force between the person and the ground. If no one is "winning," all these forces add up to zero and the person stays at rest. In order to start moving in the winning direction, the frictional force must be greater than the force from the rope.

ADVERTISEMENT

This "two-ended" nature of forces means that forces come in pairs and are an interaction between two objects. It doesn't matter how hard the person on the left pulls on the rope, this same rope pulls on that person. So if you were to increase your pull to 1,000 Newtons—that same rope pulls on both people. So the key is the other force acting in the horizontal direction: friction.

The maximum frictional force depends on two things. It depends on the types of surfaces interacting (maybe it's the rubber on a shoe interacting with a concrete floor) where some surfaces just have more friction than others. You really can't change this part in a tug of war. The friction force also depends on the normal force. The normal force is the force with which the two surfaces are pushed together. In the case of this simple tug of war above, the ground pushes up with a force equal to the gravitational weight of the person. This means that heavier people will have a greater frictional force acting to help win a tug of war.

Oh, note that in the human vs. lion tug of war the humans are on a different surface than the lion. Who has the advantage? It's probably the lion since she could have uneven ground that would allow her to use more than just plain old sliding friction.

So, it's really about mass

If you have two contestants on equal ground with similar friction materials, mass matters. If the person on the left has half the mass of the person on the right, they will have half the friction. This means that it's pretty tough to beat a heavier puller.

What about the lion? This looks like a young lion—she could have a mass of about 120 kg (up to maybe 182 kg). A typical massive human wrestler might have a mass of around 90 to 100 kg. Three humans will probably have more mass than a single female lion. Probably. The humans should have an advantage in the mass.

It's also about rope friction

Wait! This isn't a normal tug of war. The rope isn't straight. Did you notice that? This can make a big difference in that it can add another frictional force into play. Let me show you how this works with a diagram of the rope as seen from the top where it passes through the glass.

Explanation:

3 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
You shovel snow along your driveway. If you wanted to increase your power, you would _____.
Serhud [2]
<span>a-increase either your work or the time it takes b-decrease either your work or the time it takes c-increase your work or decrease the time it takes

</span>
8 0
3 years ago
Jade described one of the components of weather as follows:
dalvyx [7]

Answer:

Air temperature

Explanation:

Air temperature is being described by Jade according the properties highlighted.

The degree of hotness or coldness of a body is known as its temperature.

  • As you go higher it becomes cooler. The surface causes the warming of the air around.
  • With height, the surface is distant from the body of air.
  • On summer days, air temperature is higher due to more insolation.
  • Weather maps gives a good description of air temperature from places to places.
6 0
3 years ago
Read 2 more answers
Other questions:
  • An organism that contains two different alleles for a trait is said to be _______ for that trait.
    9·1 answer
  • What is One difference between a fundamental niche and a realized niche
    12·1 answer
  • Non-native (exotic) species can become
    9·1 answer
  • How is transported soil different from residual soil?
    8·2 answers
  • I need a slogan for RNA
    12·2 answers
  • During the process of two rails break apart and attract new nucleotide bases to form a new and complete strand
    7·1 answer
  • Can a cell make a protein directly from a gene?
    6·2 answers
  • The esophagus, stomach, and small intestines all function together to digest food and absorb nutrients. Which level of organizat
    7·2 answers
  • if a 1st quarter moon phase appears on the night of july 4th, what is the approximate date in which a 3rd quarter moon will appe
    15·1 answer
  • What directs cell activities
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!