1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vanyuwa [196]
3 years ago
13

How do organisms that are not autotrophs get they energy they need to sustain life?

Biology
1 answer:
german3 years ago
4 0
From other organisms such as plants and animas that eat plants or decompoers
You might be interested in
WILL GIVE A BRAINLEST
Tomtit [17]

using cars that get lower gas mileage

6 0
3 years ago
Read 2 more answers
What type pf response occurs when a person is infected by a bacteria​
swat32

Answer:

Internal response; when a person is infected by a bacteria or virus, the immune system springs into action to fight against the infections. Geotropism and phototropism are dealing with plants and they way they grow, while fight or flight is a physiological reaction by the human body in stressful situations-- so they are incorrect.

Explanation:

If you get it right, can I have brainliest? :)

8 0
3 years ago
1. on the trace above
ser-zykov [4K]

Answer:

1. when there is cardiovascular disease.

2. High blood pressure increases the likelihood of suffering a stroke, a heart attack, heart failure, kidney disease or premature death.

3. The mitral valve opens.

Explanation:

1. High blood pressure is a common condition in which the force exerted by blood against the walls of the arteries over the course of time is high enough to cause you health problems such as heart disease. After the first rise of pressure caused cardiac ejection volume, one notch occurs with a second ascent product of the reflection of the pulse wave. In younger individuals, with elastic arteries, said wave occurs in diastole, so does not influence the peak systolic pressure. By contrast, with advancing age and the stiffness of large vessels, the reflected wave is transmitted prior to the aorta (systole) so as to increase the peak central PAS.

2. The pressure increases progressively the pressure of the blood flowing through the arteries. As a result, you can submit the following: Arteries damaged and narrowed. High blood pressure can damage the cells of the inner lining of the arteries.

3. When the pressure in the left ventricle falls below the pressure of the left atrium, the mitral valve opens, and the left ventricle fills with blood that had been accumulating in the left atrium.

6 0
3 years ago
I need help with this question need some to help identify one to three.
Len [333]
1. Phosphate
2. Pentose sugar
3. Nitrogenous Base
6 0
3 years ago
Q.9. In volcanic areas, groundwater heated by magma is a source of _____
REY [17]

Answer:

Explanation:

D) geothermal

C) Mauna Loa

D) Lava dome

8 0
3 years ago
Other questions:
  • Your teacher is describing a plant that bears seeds and flowers, has five flower petals, and has seeds that are enclosed by frui
    11·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Scientists believe that four-legged mammals might be distant ancestors of modern-day whales. What evidence seems to support this
    8·1 answer
  • The dominant generation of lycophytes is the gameotype false or true
    13·1 answer
  • What happens to the kinetic energy of a snowball as it rolls across the lawn and gains mass.
    8·2 answers
  • What biotic and abiotic factors are involved in determining an animal's niche?
    12·1 answer
  • The table below shows the number of chromosome pairs for various organisms.
    7·2 answers
  • Describe Okasaki fragments.
    9·1 answer
  • Why are some theories more widely accepted than others such as the theory of evolution?
    10·1 answer
  • In collecting a dermal puncture specimen into a microcollection container, tapping the container on a hard surface is recommende
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!