My best answer would be the rising of sea levels would mostlikely be the outcome of increased global temperature.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Each parent give you 23 chromosomes
Call you later today I have a lot to talk about it
Answer:
M.Leakey was a paleoanthropologist of no formal university education and British origin. Her major discoveries were;
1. the proconsul skull
2. Zinjanthropus skull at Olduvai Gorge In Tanzania
3, system of classification of discovered stones.
4.Laetoli footprints at Laetoli sites.
However, her most outstanding discoveries were proconsul skull ( projecting face with no browridges, and presence of ape-like teeth shapes) and the Laetoli prints. She believed the skull belonged to ancestral Homo habilis, which could be traced to origin of mankind.
The discovery of Laetoli prints showed evidences of bipedalism and the origin of Australopithecus. These prints and the skeletons she unearthed proved that the ancestral of human race actually walked upright, nearly four feet tall in height.Hence she concluded that these prints actually belong to the Australopithecus. This brought a paradigm shift in modern understanding of human evolution of prehistoric times and the origin of mankind,
Her discoveries generally throw light on the <u>evolution of mankind </u>and new understanding of <u>genesis of human race</u>
Explanation:
