1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Minchanka [31]
3 years ago
12

Where can you find energy in molecules?

Biology
2 answers:
victus00 [196]3 years ago
4 0

Answer:

covalent bonds

Explanation:

slavikrds [6]3 years ago
3 0
Energy, molecules and chemical reactions. Energy , potential energy is stored in the covalent bonds holding atoms together in the form of molecules
You might be interested in
Is extensive loss of hair observed in humans and whales an example of homoplasy or homology? see section 25.1 (page 497) ?
marin [14]
I believe that hair and limbs are homology because all mammals have hair and similar limb structure. Hair loss and social behavior on the other hand are homolasy because not all mammals have them. Homology is the similar traits due to common ancestry while homoplasy is similar traits for other reasons other than common ancestry. 
3 0
3 years ago
The vitamin that plays a role in maintaining epithelia and is required for the synthesis of visual pigments is vitamin
Korolek [52]

The vitamin that plays an important roles in the epithelia and in the synthesis of visual pigments is vitamin A.

Vitamin A (retinol) is needed for the synthesis of photopigments. The photopigment rhodopsin is synthesized withinside the rods and is answerable for imaginative and prescient beneathneath low ranges of light. When nutritional reassets of diet A are insufficient for a protracted length of time, the quantity of visible pigment withinside the photoreceptors declines.

Vitamin A (VitA) is a micronutrient this is important for preserving imaginative and prescient, selling boom and development, and defensive epithelium and mucus integrity withinside the body.Vitamin A is critical for lots physiological processes, which includes preserving the integrity and feature of all floor tissues (epithelia): for example, the skin, the liner of the respiration tract, the gut, the bladder, the internal ear and the eye.

Read more about vitamins:

brainly.com/question/24268138

#SPJ4

7 0
1 year ago
What percentage of water is lost through the respiratory system?
attashe74 [19]
Breathing is a process to move air in and out of a system. In addition, this process may also result to loss of water. This insensible loss is from the evaporative loss from the respiratory tract. This accounts for 10% to 20% of the water. 
7 0
3 years ago
Megan observes four cells under a microscope and makes sketches of them as shown. Identify whether the cells are prokaryotic or
posledela
I cannot found the images of the microscopy anywhere. But I can explain how you can differentiate a procaryote from a eucaryote under a microscope.

The first difference between them is the size of the cell. eucaryotes are generally much bigger than procaryotes. Procaryotes are visible only at x100 objective, but eucaryotes are visible starting from the x10 zoom.

The second difference is the presence of a nucleus in eukaryotes and the absence of it in procaryotes.

The third difference is the presence of organelles in eukaryotes and the presence of a cell wall in procaryotes (only visible at electronic microscopy).
4 0
3 years ago
Fill in the blanks
BabaBlast [244]
The central nervous system (CNS), which is made up of the brain and the spinal cord, and the peripheral nervous system (PNS), which is comprised of nerves and ganglia (small concentrations of grey matter).

The brain sends messages to the peripheral nerves in the body via the spinal cord, these have control of muscles and internal organs.
8 0
3 years ago
Other questions:
  • The fourth level of cell organization is the _____.
    7·2 answers
  • Who is eligible for care within the veterans health administration?
    12·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • At one time, dinosaurs lived on Earth. Today they are extinct. This relates to _____.
    10·1 answer
  • Where would tiger sharks be found?
    14·2 answers
  • Oxygen that is split form hydrogen in photolysis is...
    5·1 answer
  • Pointsss? lol give me sum rnn
    5·1 answer
  • Q: _____ measures an object's tendency to resist change its motion
    5·2 answers
  • If you put a rock in a slingshot and draw back the rubber band, the rock will fly out at a predictable speed, depending on the d
    7·1 answer
  • Denitrifying bacteria convert nitrate into _____, thus returning nitrogen to _____.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!