1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spayn [35]
3 years ago
11

Caracterize células eucariontes dando exemplos

Biology
1 answer:
Alina [70]3 years ago
4 0

Answer:

Los organismos eucariotas incluyen protozoos, algas, hongos, plantas y animales. ... Sobre todo, las células eucariotas se definen por la presencia de un núcleo rodeado por una membrana nuclear compleja. Además, las células eucariotas se caracterizan por la presencia de orgánulos unidos a la membrana en el citoplasma.

Explanation:

You might be interested in
Temperature in the tropics all year, whereas temperature at higher latitudes. Organisms that are physiologically adapted to cons
Reptile [31]

Answer:

May not

Explanation:

Adaptation is made possible as a result of an organism being exposed to different environmental conditions. These exposure makes it adopt different techniques for its survival which eventually results in it being adapted to the condition and is then passed on as traits to its offsprings. They are then able to survive when met with such environmental condition.

When an organism is exposed to the same conditions all the time then there is lack of genetic variation and adaptation may not occur.

6 0
3 years ago
Cacti in the deserts of southwestern North America and some euphorbs of the deserts of Africa, have barrel-shaped stems, short-l
nirvana33 [79]

Answer:

       The right answer to this question is option D. Convergent evolution.

Explanation:

       Convergent evolution is a process defined by when an organism develops the same, or at least near that, characteristics, for a specific reason, but they don't have the same origin. In this case, the cacti in both deserts have pretty much the same characteristics, and this happens because both these plants need water to survive, and in order to save it, they have barrel-shaped stems, short-lived leaves, and spines. All of these things help them in saving the water and capturing it when it's possible.

        The convergent evolution is when both these organisms develop equally, but are not originally from the same place, the environment being the one to shape this.

3 0
3 years ago
Identify which statement describes a scientific law. A) The Earth is a sphere. B) The Sun will rise tomorrow morning. C) The Mil
iogann1982 [59]
I'm tied between A) and D). I say D). Hope this helps!

Aye Sir!!
7 0
3 years ago
Read 2 more answers
Which of the following are functions of the sinuses? (Select all that apply.)
Tanya [424]

Answer: D,C

Explanation:

7 0
2 years ago
Describe how the colors you see would change if you were to dive from the surface to down deep in the ocean. What would things l
Luden [163]

Answer:

Answer is below.

Explanation:

First of all, it would be much darker the deeper you go. On the surface, the light from the sun touches the ocean, making the ocean look like a light blue. However, if you dive down even deeper, you will find a darker blue, and later nothing (the sun won't touch the deep parts of the ocean, so all you would see is darkness). The short answer to this is: It's lighter around the surface, and darker the deeper you dive down into the ocean.

hope this helps

Brainly is appreciated :)

5 0
3 years ago
Other questions:
  • Which of the following protists secrete digestive enzymes to break down live
    11·1 answer
  • Need help ASAP!
    11·2 answers
  • Pelicans are large birds that usually live near water. They have large, expandable pouched bills, which are useful for _______.
    13·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What are the four bases found in DNA?
    12·2 answers
  • Cyanobacteria have been engineered to produce isobutanol directly. What advantage does this have over other alternative biofuels
    7·1 answer
  • Anemic conditions in agriculture animals result in a (blank) condition
    5·1 answer
  • How do winds blow around a hurricane?
    15·2 answers
  • A researcher is designing a laboratory experiment to determine whether the inorganic substance A affects the rate of a reaction
    9·1 answer
  • A mother A blood is married to a father with type AB blood.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!