1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mojhsa [17]
3 years ago
8

Who found that plants are composed of cells

Biology
2 answers:
Vikki [24]3 years ago
7 0

Answer:

Robert Hooke

Explanation:

liraira [26]3 years ago
3 0

Robert Hooke discovered cell structure and named cell


You might be interested in
Why is blood a slightly higher temperature than typical body temperature?
Nataly_w [17]
As the bacteria and viruses are destroyed by leukocytes, they release bursts of heat.
7 0
3 years ago
3. Determine which would have fewer protein and DNA base
Pani-rosa [81]

Answer:

Chimpanzees

Explanation:

Chimpanzees are much more closely related to humans in an evolutionary sense that cows are. Chimpanzees and humans are both primates, characterized by features like advanced cognition, grasping hands and feet, and front facing eyes. In contrast, cows belong to a different of bovine animals.

Because we are evolutionary more related to chimpanzees, that means our DNA has undergone less change over evolutionary time. That means that the sequence will be more similar to chimps

3 0
3 years ago
An abnormal condition in which the placenta separates from the uterine wall before the birth of the fetus.
almond37 [142]
The abnormal condition in which a placenta separates from the uterine wall before the birth of the fetus is known as:

Placental abruption

I hope this helps! I'm happy to answer any other questions you might have :)
4 0
3 years ago
a horse has 64 chromosomes and a donkey has 62, using your knowledge of meiosis explain why a cross between these animals produc
Pani-rosa [81]
The horse will give 32 chromosomes and donkey will give 31 chromosomes to the offspring.
The offspring has 63 in total.
 It is odd so it can not produce normal germ cell. So it is sterile.

3 0
3 years ago
The best definition of a nutrient is a
Scorpion4ik [409]

The best answer should be

D) Food component that can be stored in the body for future energy needs

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which statements describe carbon? Check all that apply.
    9·2 answers
  • How do the bees pollinate
    14·2 answers
  • A small hollow within the brain that is filled with cerebrospinal fluid
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A client develops an increased temperature after surgery. ceftriaxone (rocephin) is prescribed. for which potential effect shoul
    5·1 answer
  • How do viruses collect and use energy
    13·1 answer
  • Which is a difference between a compound light microscope and a scanning electron microscope? A: the scanning electron microscop
    12·2 answers
  • Big foreheads(F) are dominant to little foreheads. A woman with a small
    12·1 answer
  • Which of the following is an impact of beach use by humans and vehicles?
    6·2 answers
  • Why are proteins important for organisms?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!