1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
3 years ago
5

All cells have some recognizable similarities true or false

Biology
1 answer:
olga2289 [7]3 years ago
4 0
What is all cells ture
You might be interested in
What is the difference between hydrophobic and hydrophilic molecules
Jet001 [13]
The hydrophilic molecules are the polar molecules which establishes the hydrogen bonding with the water molecules. Hence the hydrophilic molecules are water loving molecules. The hydrophobic molecules are unable to establish any hydrogen bonding with the water molecules. Hence the hydrophobic molecules are water repellent molecules.
5 0
3 years ago
There are places in America and other parts of the world where herds of wild horses live, well-adapted to the environment. If mu
Art [367]

simple mules are a mix of hourse and donky and are born infertle they cant BREED.

5 0
3 years ago
14. Which of the following occurs during the electron transport chain?
Sauron [17]

Answer:

All

Explanation:

The electron transport chain is a series of four protein complexes that couple redox reactions, creating an electrochemical gradient that leads to the creation of ATP in a complete system named oxidative phosphorylation. It occurs in mitochondria in both cellular respiration and photosynthesis.

3 0
3 years ago
Read 2 more answers
The molecules that make up living things are incredibly diverse due in part to the variety of possible carbon skeletons. Which o
Rom4ik [11]

I. triple bonds, III. rings and IV. branches

7 0
3 years ago
Read 2 more answers
Which of the following is not a stage in hurricane formation?
Rasek [7]

Answer:

B

Explanation:

Because if that was the case we would have hurricanes everyday

8 0
3 years ago
Other questions:
  • How do genes mix in humans?
    8·2 answers
  • This is the stage of meiosis or mitosis when chromosomes separate to the opposite ends of the cell.
    13·1 answer
  • Two chickens are bred and have five offspring, shown below. What are the most likely genotypes of the parents?
    15·2 answers
  • The type of inheritance that involves the partial expression of two different<br> alleles is called
    15·1 answer
  • Natural gas is very common in the United States. Natural gas forms in processes taking thousands of years. So, Natural gas is
    8·1 answer
  • 1. What are the organs attacked by the smallpox virus, and what are the clinical symptoms that can develop after infection?
    6·1 answer
  • Somebody knows the answer to this
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The ___ connects with all the muscles in the body and allows them to move
    11·1 answer
  • Mitosis produces: (check all that apply!)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!