1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VashaNatasha [74]
3 years ago
5

According to the diagram which organisms do not share a common ancestor​

Biology
1 answer:
tatuchka [14]3 years ago
3 0
where is the diagram?
You might be interested in
Which is the final electron acceptor in the electron transport system of cellular respiration?
frutty [35]
Oxygen.
As Oxygen has the highest electron affinity/ negativity of them all.<span />
8 0
4 years ago
Read 2 more answers
Asap plzzzz help I will give brainliest​
g100num [7]

Answer:

The first letter of after replication

Explanation:

Everything else is the same except for the first letter

Hope this helps :)

3 0
3 years ago
Why would it be pointless for reptiles to sit on their eggs to incubate them as birds do?
8090 [49]
Reptiles are ectotherms and cannot raise their body temperature above that of the environment.
7 0
3 years ago
Read 2 more answers
4. Read the following sentence from the section "Are All Enzymes Proteins?"
ololo11 [35]

Answer:

D

Explanation:

Pretty sure that's the correct answer.

6 0
3 years ago
This is one of the processes by which ATP is synthesized. In eukaryotes, it takes place in the mitochondria during cellular resp
marissa [1.9K]

Answer:

answer you looking for is i think Phosphorylation.

Explanation:

please ask the question more meaningfully

7 0
3 years ago
Other questions:
  • If a cell was observed under the microscope and found to have a rigid cell wall and be green in colo that cell is most likely a?
    7·1 answer
  • What tells the cell what to do
    8·2 answers
  • Which is not a function of calcium in the body? blood clotting cofactor for many enzymes nerve function epithelium function musc
    9·1 answer
  • What are limitations of coal as a source of energy ?
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Plants play a crucial role in the carbon cycle because they
    15·1 answer
  • How are the rod and cone cells in the eye similar to the taste buds in your tongue?​
    5·1 answer
  • NEED HELP! PLS 40 POINTS REWARD
    5·1 answer
  • Help plz for the 3 of emmm!<br> Plzzzz and thank you!
    8·1 answer
  • Science I need to know the answer
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!