1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
insens350 [35]
2 years ago
15

In one paragraph, discuss the research findings. Does the study support genetics (nature) or environment (nurture) as a stronger

influence on human development? Use information from the article and the lesson to support your response.
Biology
1 answer:
Viefleur [7K]2 years ago
3 0

Answer:

In the study there was an experiment performed, with the experiment it was determined that twins who were separated at a young age, did not have a significant impact on their behavior. In the study scientists were surprised because the twins still had similar behaviors. That is because both twins inherited traits from their mom and dad. In the study I believe nature was more evident than nurture because even though the twins were separated they still had similar personalities. However, I do still believe that part of their personality will be influenced by their environment and the people they are surrounded.

In this study there were several research methods used. The psychologists used questionnaires to research how the twins traits and personalities develop. They also used observation, they observed the twins behaviors. But the patient and the observer could be influenced by what they are trying to discover, so this technique is biased. And they used case stud, the case studies would be the twins because they are the ones being observed and are the base of the experiment.

In one paragraph, describe the research methods used in this study and why you believe they were chosen. Be sure to use key terms such as cross-sectional research, longitudinal research, data collection, observation, case studies, questionnaires, and experimentation, as they apply. Your answer should include at least two of these key terms.

In one paragraph, discuss the research findings. Does the study support genetics (nature) or environment (nurture) as a stronger influence on human development? Use information from the article and the lesson to support your response.

Image by Tom Mooring

You might be interested in
All cellular organisms can be placed into one of three __________, which include the Bacteria, Archaea, and the Eukarya.
olchik [2.2K]

Answer:

Domains

Explanation:

All Biological organism can be classified or placed in a group.

Taxonomy is a branch of science that deals with naming and classification of biological organism based on shared characteristics.

In taxonomy, a domain is the highest order of classification or ranking ,its even higher than the kingdoms.

It is inclusive of all biological grouping.

All cellular organisms can be placed in any of the three domains namely, Bacteria, Archaea and the Eukarya.

7 0
3 years ago
3. Human skin cells divide at a higher rate than neurons (nerve cells). Hypothesize why this may be.
Katena32 [7]

Answer:

the skin cells prevent germs from coming in our bodies

Explanation:

8 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
Which water source becomes polluted as it travels over the earth
lawyer [7]
I believe a river is the answer
4 0
3 years ago
Read 2 more answers
Relate gene regulation and mutations
Bogdan [553]
Hypomorphic mutations are recessive, but haploinsufficiency causes some alleles to be dominant. A hypermorphic mutationchanges the regulation of the gene andcauses
7 0
2 years ago
Other questions:
  • What term describes the way an organism reacts to a stimuli?
    14·1 answer
  • BRAINLIEST!! Would the mass of the light bulb change as it travels from Earth to the Moon. Why or why not? please explain in a c
    6·2 answers
  • Which is one function of a protein macromolecules
    10·2 answers
  • BRAINLIEST! Can bubbles be different shapes? Write one or two sentences.
    14·1 answer
  • PLEASE HELP MEEEEE QUICKLYYYY
    10·1 answer
  • Drag the tiles to the correct boxes to complete the pairs.
    13·2 answers
  • Rachel Carson was one of the first ecologists to warn against the widespread use
    6·1 answer
  • PLEASE HELP!!!!!
    10·1 answer
  • Living things that use energy
    8·1 answer
  • Name two gonadotrophic hormones?​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!