<em>open lake </em>is a lake where water constantly flows out under almost all climatic circumstances. Because water does not remain in an open lake for any length of time, open lakes are usually fresh water: dissolved solids do not accumulate. Open lakes form in areas where precipitation is greater than evaporation. Because most of the world's water is found in areas of highly effective rainfall, most lakes are open lakes whose water eventually reaches the sea.
<em>closed lake </em>(see endorheic drainage), no water flows out, and water which is not evaporated will remain in a closed lake indefinitely. This means that closed lakes are usually saline, though this salinity varies greatly from around three parts per thousand for most of the Caspian Sea to as much as 400 parts per thousand for the Dead Sea. Only the less salty closed lakes are able to sustain life, and it is completely different from that in rivers or freshwater open lakes.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
An anticline - it is in an arch-like shape and its oldest rocks are located at its core.
Answer: Well if you look at the questions all of these are plans so im not exactly sure but the most valid answer ould be ( B )
Astronauts in the future are planning to expllre mars because they think that it is possiable for humans to live on the planet mars.
Hope this helps in some way have a great rest of your day :)
D. The Moon's rate of rotation is the same.
