1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetoff [14.1K]
3 years ago
5

If an object has a size of 0.4 mm and and image size of 80 mm. What is the magnification

Biology
2 answers:
LuckyWell [14K]3 years ago
3 0

Answer:200

Explanation:

Magnification =image size/object size

Sladkaya [172]3 years ago
3 0

Answer:

200mm

Explanation:

Magnification = Image size/Object size

Magnification = 80/0.4

Magnification = 200mm

HOPE IT HELPS YOU

You might be interested in
What are two major difference between eukaryotic cells, explain your answer?
LiRa [457]
From what other cells?
4 0
4 years ago
Why is roughage important in our daily diet​
ELEN [110]

Answer:

Roughage has numerous health benefits. It helps improve digestion and promotes gut health. It may also improve certain risk factors for heart disease and help you manage your weight and blood sugar.

Fiber-rich foods: Grams per serving size

cooked whole wheat spaghetti: 6.3 g per cup

bran flakes: 5.5 g per 3/4 cup

medium oat bran muffin: 5.2 g per muffin

Explanation:

5 0
2 years ago
Which molecule enters the Calvin Cycle? Which molecule leaves?
KonstantinChe [14]
ATP enters the Calvin Cycle. Glucose (G3P) is a molecule that leaves the cycle. 
7 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Which prediction will most likely describe how friction will affect her findings? The distance for Trial 3 will be greater than
Juliette [100K]

The complete question is :

Charlie is investigating friction. She will use the same amount of force to push two wooden balls across two level surfaces. Then she will record her results in the table below.

Which prediction will most likely describe how friction will affect her findings?

Answer:

The distance for Trial 3 will be greater than the distance for Trial 4 because the difference in surface roughness will affect friction.

Explanation:

The frictional force depends greatly on the roughness of the body surfaces. It acts opposite to the direction of motion when two body surfaces have a relative motion between them.

In the context, equal mount of force is applied to push the wooden balls. So the net force which acts on the balls are :

F' = F - f

Here, F = the force applied

         f = force of friction

And f = μ.N (N = reaction force)

Here μ is the coefficient of friction that depends on the surface roughness. The frictional force will be less when the surfaces are smooth. Thus for the trails 3 and trial 4, the distance for trail 3 would be greater than trail 4 as the surface is polished and would offer less friction.

8 0
3 years ago
Other questions:
  • Availability of substitutes plays a role in determining the bargaining power of suppliers.
    15·2 answers
  • Michael's monthly income is $3250. He has allotted 10% of his income to pay for housing expenses. What is the amount?
    6·1 answer
  • A cell in the leaf of a corn plant contains more chloroplasts then a cell in the stem of a corn plant. Based on this observation
    6·2 answers
  • Which of the following is involved in asexual reproduction?
    5·2 answers
  • PLEASEEEEEEE HELPPPPPP
    6·1 answer
  • Describe the arrangement of the water molecule to molecule with one <br> another
    12·1 answer
  • PLZ HEEEEELP WILL GIVE BRAINLIEST
    15·2 answers
  • In what ways, if any, does a single-celled organism differ from its parent?​
    7·1 answer
  • Which is an example of using a mathematical model to describe the atom?
    11·2 answers
  • Carbonic anhydrase is a protein present in red blood cells. It catalyzes a reaction to convert carbon dioxide into carbonic acid
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!