1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
4 years ago
15

What enzyme does the square represent? *

Biology
1 answer:
lakkis [162]4 years ago
3 0

Answer:chemical reaction

Explanation:Enzymes are biological molecules (typically proteins) that significantly speed up the rate of virtually all of the chemical reactions that take place within cells. They are vital for life and serve a wide range of important functions in the body, such as aiding in digestion and metabolism.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
To test your hypothesis, the same fertilizer from the farm will be mixed into the water of one aquarium (experimental) and the o
lisov135 [29]

Answer:

One significant difference that I noticed was the color of the water. In the control aquarium, the color of the water at 30 days was the same as it was on the 1st day. In the experimental aquarium, the water had a green tint on the 30th day, but on the first day it was clear.

4 0
3 years ago
Can you help me answer this question?
Anna71 [15]
C possibly, not too sure
6 0
4 years ago
What three cellular structures are found in plant cells but not animal cells?
sergeinik [125]
C! Because animal cells don’t have a cell wall! Have fun in Science!
5 0
3 years ago
What's unit for electrical power
lyudmila [28]
The unit is the Watt. S.I. unit = W
4 0
4 years ago
Other questions:
  • Describe a subculture that you are familiar with. What are the characteristics that identify it as a subculture?
    11·2 answers
  • What is the main difference between aerobic respiration and anaerobic respiration?
    13·2 answers
  • What type of doctors deal with amino acids?
    12·1 answer
  • 4.
    14·1 answer
  • After surgery for removal of cataract, a client is being discharged, and the nurse has completed discharge instruction. Which cl
    12·1 answer
  • How are hydrogen ions (H+) essential for the production of ATP.
    15·1 answer
  • Which of the following correctly identifies the function of the cell membrane?
    11·1 answer
  • Part 4- Discussion- Your response must be at least 8 sentences long. You must use complete sentences. How has science and techno
    6·1 answer
  • How many days does it take for a turkey egg to hatch
    12·2 answers
  • Discribe the processes of transcriotion and translation
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!