1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
g100num [7]
4 years ago
9

ALGEBRA 2! Please help with question 2!!!

Mathematics
1 answer:
nlexa [21]4 years ago
3 0

Answer:

√x

Step-by-step explanation:

First and foremost, simplify -3⁄6, which is -½. Now, according to the negative exponential rule, move -½ to the numerator while ALTERING THE INTEGER SYMBOL FROM NEGATIVE TO POSITIVE:

bⁿ = 1\b⁻ⁿ

This will become <em>x¹\²</em><em>.</em><em> </em>Then, you will need to use the definition of rational exponents [part I] rule to rewrite this rational exponent as a radical. This is when your numerator is 1:

ⁿ√aᵐ = aᵐ\ⁿ → x¹\² >> √x [unnecessary to write the 1 and 2]

If you are ever in need of assistance, do not hesitate to let me know by subscribing to my You-Tube channel [USERNAME: MATHEMATICS WIZARD], and as always, I am joyous to assist anyone at any time.

**In one of my You-Tube videos, it talks about all the six exponential rules. It is titled "Six Exponential Procedures". I encourage you to watch it, so you can get better at it.

You might be interested in
What function is depicted in the graph above
vesna_86 [32]

Answer:

what graph show me the graph

Step-by-step explanation:

6 0
3 years ago
Which graph shows the solution to the following system? y= 1/4x - 2
iogann1982 [59]
Y = 1/4 x - 2


=> a linear function => a straigh line


=> slope = the coefficient of x => slope = 1/4


=> x = 0 => the y-intercept = -2


=> y = 0 => 0 = 1/4 x - 2 =>x = 8 => point (8,0)


With all that information you can identify the graph because it is a straight line that passes through (0,-2) and (8,0), its inclination (slope) is 1/4, and the graph goes through the quadrants I, III and IV (there are no points in the quadrant II)..  
4 0
3 years ago
When s is the open hemisphere x 2 + y 2 + z 2 = 1, z ≤ 0 , oriented by the inward normal pointing to the origin, then the bounda
Anit [1.1K]
The figure below shows a diagram of this problem. First of all we graph the hemisphere. This one has a radius equal to 1. Given that z ≤ 0 a sphere will be valid only in the negative z-axis, that is, we will get a half of a sphere that is the hemisphere shown in the figure. We know that this hemisphere is oriented by the inward normal pointing to the origin, then we have a Differential Surface Vector called N, using the Right-hand rule <span>the boundary orientation is </span>counterclockwise.

Therefore, the answer above False

5 0
4 years ago
The formulas for power and work are and , where P= w/t is the power, W= fd
Klio2033 [76]
P = W/t
W = Fd

P = Fd/t = F/t d
6 0
4 years ago
Read 2 more answers
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
sdas [7]

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

7 0
3 years ago
Other questions:
  • A dartboard consists of a circle inscribed in a square. The area of the circle is 16π square centimeters. The area of the square
    5·2 answers
  • What’s the answer ???
    7·1 answer
  • What is the answer of. 4y+7&gt;-x-3
    12·1 answer
  • One container of Tums® costs 4.00 dollars. Each container has eighty 1.00 g tablets. Assume each Tums® is 40.0 percent CaCO₃ by
    9·1 answer
  • Can someone help me with this pleasee
    11·2 answers
  • The orange shape is a dilation of the black shape. What is the scale factor of the dilation?
    14·1 answer
  • Im tired of brainly today i will sue you if you dont clean up your ways!
    9·2 answers
  • Alvin is 9 years younger than Elga. The sum of their ages is 67. What is Elga's age?
    13·2 answers
  • Please i will give you 23 points\
    8·1 answer
  • A model of the Eiffel Tower is 41 centimeters tall. If the scale model is 1 cm/24 feet of the real Eiffel Tower, how tall is the
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!