Your own genetic code could be responsible for inviting diabetes into the cell cycle
Bacterial translation is initiated in three steps. In the final step, the large ribosomal subunit binds to the mRNA.
The ribosome's translation of an mRNA molecule occurs in three stages: initiation, elongation, and termination. The small ribosomal subunit binds to the beginning of the mRNA sequence during initiation. Most eukaryotic mRNAs initiate translation by binding Met-tRNAiMet to a 40S subunit, followed by ribosomal attachment at the 5′ end of an mRNA, scanning to the initiation codon, and joining with a 60S subunit to form an 80S ribosome. The stages of translation should be completed in the following order: Initiation, Elongation, and Termination.
Learn more about translation here:
brainly.com/question/12463306
#SPJ4
Answer:
The nutrient cycle describes the use, movement, and recycling of nutrients in the environment. Valuable elements such as carbon, oxygen, hydrogen, phosphorus, and nitrogen are essential to life and must be recycled in order for organisms to exist.
Explanation:
The nutrient cycle describes the use, movement, and recycling of nutrients in the environment. Valuable elements such as carbon, oxygen, hydrogen, phosphorus, and nitrogen are essential to life and must be recycled in order for organisms to exist.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
2. What must be done to carbon dioxide gas to change it to a solid?.
Carbon dioxide is a gas by using a metal to solidify it
3. Which is colder, dry ice or carbon dioxide gas?
Carbondioxide gas
If dry ice is placed in water, we see bubbles rise.
4. These bubbles are made of
gaseous substance in the gaseous state.
5. What happens to the size of the dry ice as the bubbling goes on?
the size of the dry ice reduces as a result of conversion of solid to liquid form
Explanation: