1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alisha [4.7K]
3 years ago
8

Provide an example of maintaining homeostasis at the system level.

Biology
1 answer:
vladimir1956 [14]3 years ago
4 0
<span>An example of homeostasis is blood sugar level. When the blood sugar level is very high, the pancreas produces insulin, and insulin tells the cells to take the glucose and use it. If cells need energy, they make the cell respiration and produce energy. If they don't need it, they convert it into glucogene or fat and store it. On the contrary, when the blood sugar level is very low, pancreas produce glucagon, which tells cells the opposite: make glucose appear! So if they don't have glucose, they convert glucagon or fat into glucose and release it into the blood.</span><span />
You might be interested in
How do u use a cell cycle in a sentence
den301095 [7]
Your own genetic code could be responsible for inviting diabetes into the cell cycle
6 0
3 years ago
During bacterial translation, initiation occurs in three steps. Which step is last?.
Olegator [25]

Bacterial translation is initiated in three steps. In the final step, the large ribosomal subunit binds to the mRNA.

The ribosome's translation of an mRNA molecule occurs in three stages: initiation, elongation, and termination. The small ribosomal subunit binds to the beginning of the mRNA sequence during initiation. Most eukaryotic mRNAs initiate translation by binding Met-tRNAiMet to a 40S subunit, followed by ribosomal attachment at the 5′ end of an mRNA, scanning to the initiation codon, and joining with a 60S subunit to form an 80S ribosome. The stages of translation should be completed in the following order: Initiation, Elongation, and Termination.

Learn more about translation here:

brainly.com/question/12463306

#SPJ4

3 0
1 year ago
Explain nutrient recycling and importance of water cycle​
lakkis [162]

Answer:

The nutrient cycle describes the use, movement, and recycling of nutrients in the environment. Valuable elements such as carbon, oxygen, hydrogen, phosphorus, and nitrogen are essential to life and must be recycled in order for organisms to exist.

Explanation:

The nutrient cycle describes the use, movement, and recycling of nutrients in the environment. Valuable elements such as carbon, oxygen, hydrogen, phosphorus, and nitrogen are essential to life and must be recycled in order for organisms to exist.

6 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
2. What must be done to carbon dioxide gas to change it to a solid?.
photoshop1234 [79]

Answer:

2. What must be done to carbon dioxide gas to change it to a solid?.

Carbon dioxide is a gas by using a metal to solidify it

3. Which is colder, dry ice or carbon dioxide gas?

Carbondioxide gas

If dry ice is placed in water, we see bubbles rise.

4. These bubbles are made of gaseous substance in the  gaseous state.

5. What happens to the size of the dry ice as the bubbling goes on?

the size of the dry ice reduces as a result of conversion of solid to liquid form

Explanation:

8 0
3 years ago
Other questions:
  • What type of rna is produced in the nucleus
    10·2 answers
  • How does technology affect the advancment of science
    10·1 answer
  • Explain how two organisms can have the same phenotypes but different genotype s?
    9·1 answer
  • What role do converging plates play in the formation of volcanoes
    9·1 answer
  • Fishes and frogs do not feed and care their babies,give reasons
    5·2 answers
  • What are animals that do this in the soil: create holes for air and water to reach bedrock?
    12·1 answer
  • Urmmm.. so i need help againnn..
    5·1 answer
  • Explain Why is it important for organisms to maintain homeostasis?
    6·1 answer
  • Que pasaría si que pasaría si que pasaría si?
    14·1 answer
  • Which of these statements about Earth’s magnetic poles is NOT correct?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!