1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alisha [4.7K]
3 years ago
8

Provide an example of maintaining homeostasis at the system level.

Biology
1 answer:
vladimir1956 [14]3 years ago
4 0
<span>An example of homeostasis is blood sugar level. When the blood sugar level is very high, the pancreas produces insulin, and insulin tells the cells to take the glucose and use it. If cells need energy, they make the cell respiration and produce energy. If they don't need it, they convert it into glucogene or fat and store it. On the contrary, when the blood sugar level is very low, pancreas produce glucagon, which tells cells the opposite: make glucose appear! So if they don't have glucose, they convert glucagon or fat into glucose and release it into the blood.</span><span />
You might be interested in
Which requires moreland production soy protein or meat protein
sineoko [7]
Soy protein would require more land production
8 0
3 years ago
Read 2 more answers
How do root hairs help roots absorb water?
MrRissso [65]
Root hair absorbs water from the soil by osmosis.
8 0
3 years ago
Read 2 more answers
Which of the following plants and trees ? ( mango and pine . rose and coffee . cucumber and gourd .)​
iren2701 [21]

Answer:

mango and pine

Explanation:

6 0
3 years ago
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
What two organelles are included in the endosymbiosis theory?
timofeeve [1]
Chloroplast and mitochondria. Because both organelles are roughly the same size and shape as bacteria, have their own double layer membrane, and mitochondria have dna, that they were engulfed by early cells and are now organelles.
5 0
3 years ago
Other questions:
  • Predators are considered a(n) _________ limiting factor PLEASE HELP!  abiotic                        external                   
    14·2 answers
  • ___ is the oldest possible age that members of a species can attain, whereas ______ is the average number of years the average n
    5·1 answer
  • Hydrophobic substances such as vegetable oil are
    9·1 answer
  • What is the most common rock on earth
    6·2 answers
  • The number that is used to show the value of one currency compared to another is called the __________.
    11·2 answers
  • Largest planet in our Solar system with faint rings.
    8·2 answers
  • A flood plain forms where a stream. ?
    13·1 answer
  • Explain how a protein is formed. Begin your explanation in the nucleus and end with a formed protein.
    11·1 answer
  • Compound X is used as an energy source in respiration.<br> Suggest the name of compound X.
    6·1 answer
  • What method or technology could reduce<br> the runoff?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!